Description :
From Genome Similarity Track
Location :
Scaffold_1259:1120- 3349
Sequence
2229 bases(100 bases per row)
CAATGGCCATTACCTCGGGAGCAAGTACTAGCGATCGACAAATTATTTGCAGATCGCTTAGCGGCCGGCCATGTGAGGGATTCGACCTCCCCACATAGCT
CTCCGACCTTCTGTGTGAGGAAATCCACAGGAGGGTGGTGGATAGTACATGCCTTCAACTGGCTGGATGCTGAATGCTGCAACTGTAACGGCTCGAACAT
CAATACCAAGAAAAGACGTCATCATCGATGGTATGGAAAAGAGTAACATCTTTTTATCAATGTATTGGATGAAAGGATTCTATCATATCCATATGCGCGA
AGGGGACATTCCCTATACTGCAGTGATCACCCCAAGTGGTATGCTTTGGGAGTGGTTAGTAATGTCACAACGGCTAAGTAGTACCTCTTCCCGTTCAACA
GATGTGTGACGAATCTTTTAATATCCGTAAGAGAGTTCGCGTCGAGCAACTTCGATGATGTATTTTCCATAGAAGGGCTATGGGCGGACAGACGGATGTG
GAAGTACACCGACATAACCGTCGGAAGGTTCTTACAATTATGCGCGACCATAAGTTGTACGTCAATCTCAAGAAGTTTATATTTACTGCTAGCGTATTAC
CACTTCTTGGTTACATCGTAGGTAAGCATGGGGTCCGGCCCGATCCGGAAAAGATCAAAGAGATAACGGACTGACCGGCGCCTACAATGTCAAGGGACTT
CGAAATTTCCTTGGCCTAGCGGCGTATTTGCACAAATACTCGCACAATCACTCCGAGATGATTGTTAACCTCTATTGTTTATTGAAAAAGAACAAGAAGT
GGATATGGTATGCTGATTGTCAGCGCTCCTTCGAGGTATGAAGCGAAGCTTGATACGATCGCCAGTTTTAGCAACTTCAGACCAAGAAAGGACATTCCAT
GTGGTTTGTGACGCCAGTTACTTTGCAATAGGCTGTACATCAATACAGTACGACGCAGACGGTGCGGAACGTGTCGTCCGATATCAGTCACGTCAGCTGC
ATCCAGCTGAACTTAATCATCCTGTCCATGAAAAGGAACTCCTTGCCAAGAAGTACGCGTTGGCGAGTTTAGAGTCTACCTGTTAGGCGATAGATCCTTC
ATCATTTATACGGACCGCGTCTTTATGCACAGCTATAAGCAGTCCACATCTTCCGCAGATGATGGCGAGGTGACTGTCATTCTTTGCGGATTACAACTTC
TCCGTCGAATATAAGCCAGGACGACTTAATGTCGTCGGTGACGCACTCTTGCGCCGGCCCGATTTCGAACCGACTGCGCCACCCGACACTGGTCCGACCA
CTGTCGCGGTACAGACTTCGCGTGTCCAGTCGTCAACTTTCTCGGAAGACATATATAAGGCGTATGATCCGTGAATGGTGCAATTGATGCATCATCTCTC
GCGCCCATCCGGGAAGAGCCTTAAACAGTTGTCGTCAGTATATCGATCCTCTACGAATTGATATACAGCTCGCAACGTCTTACTCCAATATTCGGCTGTT
GCCAGCGAAACGCCTCGTGTAGTCGTACCAGATCATGGTGACCTGAGATTGCGTATCATGTATGAGTACCACGATGCACCTACTGGTGGACATCGTGGTC
GAGAGAAGACATATTCCACAGTGAGCCGCGACTTTTACTGGCACCGTCAGTATTAGTTCGTGCGCAAGTACTTTCGGGCCTGTGAGGTCTGTCAACGAAT
GAAATCTAGTCCTTCCCTTCGAGCCCCGTTGCAGCCTCTGCCCGTCCTGGCCGAGTGATGGGAATCCGTCTCAATTGACTTTTCTTTGGATTCCCTGTCG
ACTCTCACAACAATACTGGTATTCTTGTGATCGTTGACAGGTTCAGAAAGATGGTGCATCTGGTTGCTGTACCTGAATCAATCAAAGTATCGGCTTGTGC
CCGTGTTATCGACACGGTCTTCCGCCTTCATGGATTGCCTCGTGAACTCGTGTCCGATCGGGACCCGCGATTCAACGCTGAGTTCTGGCGTTCCGTGTTC
AAAACACTCGGAACGCGCCTTCAGATGTCGAACTCTGACCACCCTGAAACAGATGGTAAAACAGAACGTGCAAACCACGTTCTTGAGGAAATCCTTCGGG
CTTATGTCCATTCGTTTACGAATTGGAGCGAATTCTTGCCAATGTTGGAATTTGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCATTCCT
CGTGAATGGCGTGCGTCACCCACAACTAC