Description :
From Genome Similarity Track
Location :
Scaffold_2299:1120- 3334
Sequence
2214 bases(100 bases per row)
CGAGGTGGTTTGGTGCGGGCGAGTCATTGACGGGCAGGGTGTGTCGCACGATCCTTCGCGTCTCGCCGCATTGCGGGACATGCAGCTACCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGATTTTGCTCGACTCATCGAGCCATTACGAGA
AAAGCTCGAAGCCGTGATGGCAGTGCGCGGGCGCAGGAAGGCCCAATTACGTGGGGCAGTGCTGACATGGTCTGGGGACGACGTTGCTGCCTTCCAAGCT
GTGATCGGTGCCACTGAGCNNNNNNNNNNTGTCCAGAGACGGTACTTTGCAGACACCGAGGCCGTCGTGTGCATGTTCACGGACGCCTCGAAGACTGGGT
GGGCCATGATCACCACTCAGGTCGGCACCCGGCGTGCTGGTCCAAGATCAACAGCACGAGCTCCTAATCTGTAAAGGGGGTATGTTCAAGAACGCACAGC
TGAACTGGTCGGTTATTGAAAAAGAGGCGTACCCTATCGTCAAGGCGTGCACCGAGCTGGAGTATATGCTCGATCGCGAGAATGGTTTTCGCATGTATTG
CGATCACTCGAATCTCATCCAGGTCTTTGCGCCCGGCACCGACGTCAAACAGCATATCAAAGGAAAGCTCCAACGCTGGGTATTGAAAATGGCTGCATAC
CGCTACACTATCTCGCATATCCCAGAGGATAACCTGTGGGCAGACATGGTATCGCGCTGGGACCAGCCAGGGAACAGTGTCCCACTGACTGTCTTCGTCC
GACGTGTGGTGACGCGCAGTGTGGCCGGGCCCTCCATTTTGCGTCCGCTCCAGGACTCGGAATTTGAGTGGCCAGGGAAGGACGATATCGTCCAAGGGAC
TCGTGAGGGCATGCTCTTTATAGGCGACAAGGTGTGGGTGCCTGCGAAGGCCCACGCGCTCATCCAGCGCCTACTGGTGATTGGGCATTGCGGAACTGAA
GGACACCGCGGCATGAACGTTATGATTGAGCATCTGAGCCGCCGATTCAGCTTCGATGGCCTGCGCTCGAGTGCCCAACGGTTTGTGGGCGAGTGTCTTC
TACGCAAACATGTGAAAGGCGGTCGCCTCATCCTGAGGGACTGGACAATGGCTCGCAGCAGCACGAAGCCGAACGACTGTCTGCACATCGACTACCTCTA
TCTTGGTGATAGCTACGGTGATGCCAAGTATGTACTGGTATTAAAGGACGAGTTCACACACTACTTTGAACTGGTAGCCGCGGATTCAGCCAATGTCGTG
ACGGCTGCCCATGCGGTACTCGATTGGTACAAGCGCTTCGGCCTGCCGGCTGAGTGGGTTTCCGACAATGGATCCCATTTCAAGAATCATTTGATGGACG
AGTTGGCCGGACGGCTTCGCGTGTCGCATACCTTTGTTCCAGTATACACTCCCTGGATTAATGGTACGGTTGAGCGAGTCAACCGCGACATCCTGCAAGT
AATGCGAGTCCTACTCATGGAGCTGCGCCTCGACACGCGCAATTGGGTGCATCTACTGCCGTTGATCCAGGGCAATCTGAACCACAGTCCGGTGGCGTCC
CTAGCAGGCCTAGCACCTATTGAGTTGTTCACGGGTCTGCCCGCGGGATCGGCTCTCGATGCCGTCGACATCCCGACTGAGCGTGTACCGCGCCAGGTTC
CACAAGACGCTGCGGGACTGCAAGAAGGTCTGGCGGATTTGAGAGCCAGTCTCCAGGCCATGCACCAGCAAGTCCAAGATGTGCGCGAGCAGCGACGCGC
GTCAAACATGGCACGCTCGAAGGGCACAACGTGCAATTTCTCTGAGGGGGATTACGTACTCTGGTCCCGCGTTGACAAGCGGATCCGAGGCAACAAGCTT
TTAGCCCGCTGGGTTGGCCCTTTCCGCGTCGCCAAGGCCCTCCCACACTCTTTCCTCATCGAGCATCTGCTCACAGGAGACGAGTTTGATGTGCACGGAT
CGCGTCTCAAGTTCTACTCTGATGCTGAGCTCAACGTGACCGTGGAAGTGCGCGAGCACGTCGCCGCGCAGGGTATTGTTCTGGGTGTCCGCGGAATCGT
TCGCCACCGCAAGAACACTGCATCAGGCGAGTGGGAGCTCCTCGTCAGCTGGCAGGGCCTCCAGGACCTCGAGAACTCGTGGGAACCGTTCGACAGCATG
CTGGCGGACGTTCC