Description :
From Genome Similarity Track
Location :
Scaffold_410:1120- 2350
Transcript NameFunction/comments
Phypl_g7995hypothetical protein PHYSODRAFT_510673

Sequence
1230 bases(100 bases per row)
TCTGAGCAGAGCTCGAGGCGTAGTCAACGAAAGTAGGATACGACTTGATGGTCTCGAGAGCAGTCGCGCCGCTATGAGACGAGAAGTTGCCGCTGTTCAC
GAGCTCGTTGGCCACGCACGACCGACCAAGTAGACTGGTACACTCATCCTCACTGTCCGCAGCGTACAGAGCGCCTTCATCCCCCTTGTTGTATAGCGGC
ATCCGCGTGTCGCGGAAGTAGTTGCCTTCAGCAACAACCCAAGCGTTCGAGCCGATCTCGAACGAGTGGCCAGAGTTGTTTCCCCAGAAGTTGTTGgcga
cgtgagcgacgacgttggCAGCGCTGTCACCACCGATCTTGGGCGAACGGCCCGAAGTGCCGTGAATGTAGTTGTTGAGCATGCTGAACTTCGTGACACC
GTAGAAGATGAACGACCAGTAGTGGTGGCCGTCGCAAGTGGCGGAGTAGTCCGTGTTGCCGTCGAAGTCCGAGTTACTGATGGTCATGGAATCGGTGCTC
GCCTTGTTGGTCGTGGTGAACTGGCGACCAACGCGGGAGATCTTGATGTGGTCGAGCCAAATGTTCTTCAtggccgtcgtgctcttgTCAGTTCCTTGGA
TGTAAATGGCATCACCTCCCCAGACGAGATGGTGGTTCAGCTCGGTAATGTGAACGTTCTGGACGATGATGTTGTGGCCGTTGAGCGTCAATCCCTTGCC
CTTGATCACGCCGCCCTTGCCGATGCCGCGCAGGGTCTTGTTGCCTTTCACAGTCATGCGCTTGAGGGCGGCGTTGTCATAGGTCACCGTAGTCTCCGTA
CCGTTGTCACAGCCGCCCGTGTTCGTCATGCCACCGCTCTGAAGAATGACGTCCTGGCTTTTGAAGCCGTTGTTCTTGGCAATGCACTCACGGGTGTACT
GTGGACGACAGCCCGGCTCAGTGGTCGTACCCTCCGTGCCGCGGAAGTCGAAGGTTTTGTTCAGCATAACCACCAGAGGCTCCGAAGAGTTGAGGTAGGC
GATCAGCTCCTGGGTCGTGGCCGGGTACACGACGGTGCCGTTGCCGCCACCGGTGGCGCCGGCAGCAAGACCTTCGGGGGTGCCGATAGTGAAGCCGTTT
GCGCTCTTGGTGACGAGGGCCAATGCGGCGGCCAGAGCGAACTGGATACGTCCCATAGCTGAGAAGTGGAGAGGTCTTGAGGTAGGCGGGTGGAGTGCAG
TGCTCAAGGCGAAGCAAATTTGAGAATGAC