Description :
From Genome Similarity Track
Location :
Scaffold_1066:112- 3240
Transcript NameFunction/comments
Phymu_g12674conserved hypothetical protein
Phymu_g12675hypothetical protein

Sequence
3128 bases(100 bases per row)
TCGAGTACTCGTGTAACGGGCTAATTGCAGCCCGTTACGTGTATGGAGATAGAGGAAGTATCTGGCAAATTGAACTCTGATTGATTGACGAGACGGCCTT
GACAAGCAAGGCCGTCGCAGCCATTAAAGCTATTCTTGGGATCTGATTGGCCACCGCGCACTCGCGGTGGCAACCGTGTGACAGTGTCCTGTCACACCAC
CCCCTACTAAGATTCGAAGATACGTACTGGAGAAACGTGGCCGCTACGGTGGTGGTCACACGACAACTTGAGCTCGGAGACGAAGaacggcagcggcggc
ttCAACTATGGGTGACGCAGGTGGTGAAGGTAGCGCGGGGAACAGACCCGTACCAGAGGCGCGAGACTTCGTCACGTACGCGGAAGAGCTGGGGAGGTGG
ACCGTGTACGACTACAGCGGCCTTCGCGAGGCGctgagcgacgacgagatgcgGAGCCTCTTCCATCGGCATCGCCAGACGCGAAGTAAGCCAGTCACGG
CGACACGGACCGTgacgatgacgtcgctcGATCACGCGTGGACATCCTTTGTGCATCGGTTGAACACCGAGGGCGCCGCCAGGTTCATCACTTCCCTTGA
AAGACGCGAAGCCGAGCATCGAGCGCGGTCTGTGAGCGCGCTGGCGAAGCGGATTCATGACATCGCGTATGACGCCGACTGAGACTGCTGTTACGTTCAC
TACGCCAGGGGCTGCACCTGGTGTCATGAAAGCGGGCGCAGAAGACCCAACGAAGACGAGTGgaggcttctgctccagGAGAACCCAATCGCCGAAGCCG
AAAACCAAGTTGTGAACCAGTACCGTAACGCTGAGAGTCAAGCTAGGCGCGGCGGGCGGCCGCGCCACCCGGAAGACCTACCGCCGTTGGAACCACCGCT
TCGTACGCCGCCACACAATCCGGGACgtcctcgagcagcaccgctCGAGGCTCCCAACTATCAGGCATGGGACCAAGCCAGCGCACGAGATACTGGCGGT
GAAGCGGGATTGGGTCGTCGCGGGCAACGCGACCGCGACTGCGACCGCGACTCGTACGCGCGTGCTGCGGGACGGCACGATGATCATCGTGCCCCAAGAT
GGCTTCAACAATATGACGAGTACGGCCAGCACCATCGACAAGGGATGCTGGACCATCGCGCTGGAAACGCGCCGCGGGGTCGGCgggaggaggcggaggc
tgcgCGGGGTCGACAGCGCGCAGCGGAACGGTTGACGCGGCTGGAGCGTGAGATGGCGGAGTTGCGTCGCGAGCTGGATGTGATGCAGGAGCCTCCGCGC
GAGGAGCGGGGGCGTCAAGACTGGCGGGAAGCAGCACCGTGGGAGTATCAGCGGCGCTAGGAATGACAGCGGGGTGGTAACGTCGGAGGCGACCGACGTA
GAAGGTAGGATGGAGCCGCAGAGCAGTAGGCAACTGTAGCGTGTAGGCGTCACCCAATACCTTTAGTATCTTGAAAGGCCCAATAAATCGTGGCGCGAGC
TTGTTCGCGCCCAAGTTTGTCAGCAAAGTGGGTTGGATGCCGGCCGTGGACAGTAACACACGGTCGCCCACGGCAAATTTCTCCATGTTCTTGCGACCGC
GACGATCGGCATTCTCCTTCTGTCGATCAACTGCCATCGCGATGGCGTCCCGAACATATCGCACAACAGACTGGCGCCGATCAAGAAACGCGTTGACCGC
CGCAGTGTCACTCGACTGCGGCTCCGGGTTGGGGTCGAAGTtcgctggaggtggcgcgGCGACGCCAGCCGCGCCCGTTGCCTCTTAATACTCGATTGCA
CGACGACGCTGACTCGGGTTGATCAGCGTCCGACTGGTCCAGGTGGCGATCTCTGAAGGTGTCGCCCTCGTGGCGACACGCGCACGCAGCCCACGCGCCG
TGGTCTCGGTTGGTCTCTCTGGTGCCGCTCTTGTGGCGGCGCGCGTCCGCAttccacgtgctgcgtctcGGGCTCCATGATGAGTGGTGACTCCGTTCAC
CAGCGTGGAGCCAGCGTCGTGACCACTCTCACGACCGGTTGTACCAGCGACCTCGGTGCCGCTGGAGTCACCAATCTCGTTCAAGACGTTATTGTCACTG
GCCTCACCCAGGACCATCGAGCGCTCCAACCCAAGGAGCGCTGGCACTCGGGGATGGCGACCGCAGTTGATGTAGAAGGGCGTCAGCCCCGTCGACGCGT
GCTCGGCGTTGTTGATGGCGAACTCGACCATGGGTAGGAAGGAGCTCCATGACTTAAAAGACGTGGCGAAGCTCCTCAGCACGTCTTCGACTACCCTGTT
CGCACGTTCGGTTTGGCCGTCCGTCTCTGGATGTGACGCGGTGGACATCTTCAACCGCGTCCCCAAcgtcttgaagagctctgTCCAGAAGGCAGCGGTA
AATCTCGGGTCTCGATCGGAGACGATCGAGGTCGGTAGACCGTGGTGCCGATACACGATGTCGAGGAAGATCGCCGCGGACTGCACTGCGGTGACTGAGA
CGTCGACTGGAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACGAGAACACCAGTGCGGCCTTGAGCATCGCGAGGCAgtccgaagacgaagtc
CATACTCACCGAAGACCACGGTTCTGTCGCAACAGGGAGTGGTCGAAGCGGCGCTTGCTTCGACGGAGACGGCTTGACACGCTGGCACGCTTCACACGAG
CGTACCCACTTCCGCACCCACTTGTACATATGCGGCCAGTAGAAGTCGCGAGACAGCGACGCGAACGTTTTCTCGCGTCCAAGGTGGCCACCACTCGGGG
TGTCGTGGAACTCATGTATTAAACGAGCACGAAgatcgtcgtccagcgagaCGACGATGCGCGGAGGATCCGAGCGGTCGACACAATATGTCAGCAGGTT
GCCATCCAGGGCGTAGCGATCGACACGGGCGCGGCTACGCGAAGACAGTCGGCGTCGCGCCGTGTCCGACGGGTCCCGCATGTACTTCAACATCTCGGCG
CACTCTGCATCCGAGTCGTACGCAGCCGAGATCAGGTCGCGCAGTGGACTGGTCGCTGCAACCTCGACCGCAGCCATTCCTTCGGCGACACACACAGCAC
actcgtcgtcatcttcgtcgccaaTCGC