Description :
From Genome Similarity Track
Location :
Scaffold_1712:112- 2122
Sequence
2010 bases(100 bases per row)
TGGTTATGGAGTGCCTTATGTCAGCTCTCTTTCGAAGATATCAAACAAAGCTTGATACCATCGCCAGTTTTGGCGATTGCAGATCAAGACAGAACATTCC
ACGTGGTCTGTGACGCCAGTGACTTTGCAATCGGCTGCACATTAATGCAGACCATGCGGAGCGTGTCGTCTGTTACCAGTCATGCCAGCTGCAACCAACT
CAACGCAACTACCCCATCCATGAAAAGGAACTCCTTACCATGACGTACTCGCTGGCTAAATTCAGAGTCGATCTGCTAGGTGATAGACCCTTCATCGTTT
TCACGGACCATGAGTCTTTACGCACAGCCGTAAACAGTCCACACATGTCGCAGCAGATGGCGAGGTGGCTATCATTCTTTGCAGAGTATAACTCCTCCGT
CGAGTATAATCCAGGATGACTTAACGTCGTCGCTGACGCACTCTCGCGCCGGCCCTATCTCGAGCCGGCTGCGCCACTCGACACTGGTCCGACCACTGTC
GCGGTACTGACTTCGAGTGTCCCGTCGTCAACCCTTTTGAAAGACAAACGAAAGACGTATACTCCGGGAATGTTTTGATTGATGCATCATCTCTCGTACC
CATCCGGGAAGATGCTCAAACAGTTGTCGTCAGTATATCGATCCTCTACGGATGGATATACAGTTCGCAACGGCTTACTCCAACATTCGGCCGTTGCTGG
CGACACAACTCGTGTCGTCGTACCAGATGATGGTGATCTGCGATTGCGTATCATGTATGAGTACCACGACGCACTTATTGGTGGACATCGTGGTCGTGAG
AAAACATATCTCACAGTGGGCCGCGACTTATACTGGCCCCGCCAGTATCCGTTCGTGCGCAAGTACGTTCGGGCCTGTGAGGTCTGTCAACGAGTGAAGT
CTATTCCTTACATCGAGCCCCGTTGCAGCCTCTGCCCGTCCTGGCCGAGTGCTGGGATTCTGTTTCAATGGACTTTGTCTTTGGATTCCCCGCAGGTTCT
CACAAGAATACTGGTATTCTTGTGTTCGTTGACAGGTTCAGCAAGATGGTACATCTGGCTGCTGTACCCGAATCAATCAACGCATAGGCTTATGCCCGTG
TCTTTATCGACACGGTCTTTCGCCTTCATGGGTTGCCTCGTGAACTTGTGTCCGACAGGGACCCGCGGTTCACAGCTGAGTTCTGGCGTTCCGTGAATAA
AACACTCGGAACGCGCGTAAAGATGTCCACGTCTGACCATCCTGAAACAGATGATCAGACCGAACGCGCGAATCGTGTCCTCGGGGAGATCCTTCGAGGA
TACGTTCATTCCTTTACGAATTGGAGCGAATTCCTGCCGATGGTGGAGCTCGCCATCAACAATTTAGTCATGCGTCGACGAAGTACACGCCTTTCTTCGT
GATTGGCTGACGCCATCCGCGCCTTCCCACCTATTTAGAGTGTGACTCTCGTTTAAGGGGGGGGGCTCATTCGAGCGACCGTCAATCCGGCTCTCACTCT
TCACGCGCTGATTATGAGTTCACCACGTTCGATGCCGACGTCGATCACATCGACTTCAGTAAAGAAGAAGAAAGTAAGAGAGAGGATGCTCTTACTGACC
ACGATACTGATCTAATCAGCATCACGCCTAGTGCACCCAAAGACAAACTAACAGAGGCGATAAGTGATCTTGCTACAGTACGCTCCAAGAGCACTGCAGC
TAAAGACAGCGAGTCAGCAGATGAATTCATACTGGCTCGAGAAACGGTGGTCCGTTTCGTACAAGACTCTATCACAGAGGCGGTAGATCGACAAAACGAA
ACGCCGACAAGGATGAAAGTGGAAATGTTCTTTTATTCAATAAAGGCGACTTAGTCCTACTACTCACAGTAAACCTACCTCGACACATAGTGACCTACGT
AAGAAGTAACAAGTTACTGCCCAAGTTCATCGTTCCATTTCGTGTGCTGCGCCGCCTACGCAACGCATAAACGATTGAACTGCCATGTAGATGCACACGC
ATCCTACGTT