Description :
From Genome Similarity Track
Location :
Scaffold_1764:112- 1363
Sequence
1251 bases(100 bases per row)
TGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCG
AAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGC
TGGTGTGTTCGACGCAGAGGAAATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAA
AGGTCGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCG
AACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGTGAAAGCTCGGGA
TCCAGTACGCCCTACGCGTGATTTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAAT
CGCCTCACGGATCCAGTCCCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCGCGGGCACCCTGCAACGGCACTTTGAAGCTGCGATGAATC
GCTTCCTGCCCAACAGGGTATGAGAGCGCCCGTGCCCCCAAGTGCAAGTGCTCCATGAACATGGAGCACGGGACGTGGAGATGGAGTCAGTAGAGGGGGA
CAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACGGCCCCACCCGGGGCAGGTGGATCGTCCATG
ATTCAGAGGGTACGGATCTCAGCTATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGT
CGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTCCGGATCTGCTAGCGGGCCCACCCAGGAACTGGTATCGGCAGCTGGGCAG
ATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGC
AGATCGGATGAATCCCCGTTGGAATATCTACATCGACTAAATGTGGCCGGT