Description :
From Genome Similarity Track
Location :
Scaffold_2299:112- 1340
Sequence
1228 bases(100 bases per row)
TCCACGATGAGATTCTGCATCACTACCACGCGAGTCTGACCGGCGGGCACCAAGGGATCTCCCGCACTTACGAGAAGGTCAAGCGACACTTCCACTGGAG
AGGGATCCACAAGTCAGTACAGAAGTACGTCGGATCGTGCATCGATTGTGAAACCGGCAAAGGTCAACCTCGGATCCGCAGTCAGTCTCCCGGGAACATC
GTAGCGAAGCGACCATTCCAGGTTCTCGGTATGGATCACATACCGTCGCTACCGGAAACCTACCGTGGCAACACCGAGCTGCTCTTGTGGATCGACCAGC
ACTCAGGCTATGTGATCGCGTCGGCCAACCCAAACCGTGAAGCCCAGACCGTCGCCGAGTCATACGAACGTTGTGTATTCCGTCGCTTCGGTGCGAGTGA
GGTGATCAGACATGATCGCGAACCGAGTTTCATGTCGGAGGTATTCAAGGCCTTCAACCGGCTGATCGGGCAACAGAGTCGTGCAACTCTTGCCTATCGG
CCACAAGCCAATGGGATGACAGAACGCATGGTAGGCACGATCACGCGAGCAATCAAGATGTTCGTTCAGGACAAGGATCAGAAGGACTGGGATGAGTTCG
CTGAGCGCCTCGTGTTTGCGCTGAATACTGCCTACGACCGCACAAGGGAAGAGACACCACACTATCTCGTACACGGCTGGGATCCACGAACTACGCTGGA
GGTGGCTACACCAAGAGCGGATCCAGGGATCTCAGCTAGTAACCCGAAGGTCTGGCGCAACATGGTTCAGCGTGATTACACTTACGCACGCGCAGCGGCC
AATCAATTGTTGGAGGCAGCTATGCGGACTCGAGCGGCCGAGGCCAATAAGATCGCGACTGGAGGCGACGAGATCGTTGTCGGATCACAGGTGTGGCTAT
TCTTTAATCGTACCAAGCCTGGTTACGCTCGCAAGCTCGCGCATCTATGGCATGGACCTTTCAGAGTGGCTGATCGGCTCGGGAACTACCTACTGAGACT
CGAGATCCAAGGTTCAGAGTATCAGTTCTTCCCTATCGTCCATGTTAATCGCGTGAAAGCTCGACGCACCTATGCGGAGCGACCGGACGCCGAACTCGTG
ACAGATGGCGAGCGCTTTGATTTTGACGAAGCCCTCTTACCGGAAGACAGCTGGGATCCGCGGGAAGAAGCAGGCGAGTACGAAGTTGATGAGATCCTGG
ATCAGCGGTATGAGAAGCGCACACGCCA