Description :
From Genome Similarity Track
Location :
Scaffold_3954:112- 1197
Transcript NameFunction/comments
Phypl_g16112predicted protein

Sequence
1085 bases(100 bases per row)
CATTCGACAGTCCCTGTGCATAACACCTACGCGGGTGGATTGAACTACCTGAAATCCTCTGTGGTCTCTAGAAAGTGAGCCACCATGGATCGAGGAGAGT
TTCCTCATTTGACCGACGCTCAGTTTGAGTCGGTCCGGAAGATGGCGGGCATCTTTGGGATGGATGCCTTCCGaagcttggcggcggcaccgccgcccga
gcaggtcgagcgcgTGAATGCGTTCGACACCTACGAGCGTGGGCTCATCGCTCACGTGCAGGGGTTACAGCCTCCCCAGGCTGTGCCGAGGCCGGCCCAG
CCGAAGCCCTTGAGGCTGAAGGTCCAGGCCTACGGCGGGAAGGAAGGTGAGAACCTTCACTTCTGGGTCCGAGAGGTTGAGCTCGCGATGGACGCGGCCC
TACTCTCGGACGAGCGACTTCGTGTTGCTTTTGCGCTCTCGCATCTCGGCGNAGAGCTGGGCGTACACGCGGGAAGCGACGTCGCCTGGATGTTTCACAT
CCTGGGCCCAGCTGTGTGATCAGCTGCGAGCCGCTTTCCTCCCGGCGAACTATGAGTATCGCCAGCGCTCACGCTTCCTTGCCCGCAAGCATGGAAAacg
tgagctgcacgagtaCATCCATGAGATGCGCGAGCTAATCGCATCTCTGGTGGGGAACCCACATCAAGGTGACGGTGTTCATGGACGGACTCCGTGTGGG
CCCTGCTCGCACGCAGTTGTTCCGCGTGCAAGTCAGCACCCTGGAAGAGGCGATCCAGATCGCTCTTCAGGAGGAGTACAGCCACAAGCAGGCTCGTATC
CCCACCACGGCGTGGTACGGCCACGCAGGCACGAGCAGTAGCTCCACCAGGGGTGCTCCAAATGGTCCAGTGCCGATGGACCTGAGCATGATCGAGCATA
GTAATATCCGCTGCTATGGATGCGGCAAGCTGGGGCACATTCAGTAGGTAAGCTGGGGCACATTCAGTAGCCAGTAGGGGCGGGGCGCCCTACTGGGGAA
GACCTAAGTCTTCATGAGCGGtgcgcgggcggcgcgcaCCATGAAGGCTTAGCCCCTGAGAGTCTCTGCACTCTCGAACAGAAGA