Description :
From Genome Similarity Track
Location :
Scaffold_875:11199- 13152
Transcript NameFunction/comments
g18009.t1hypothetical protein

Sequence
1953 bases(100 bases per row)
CTTGAGCACTTGGACACGCTCCCACACGCTTGTTCTCACGCGCACGCAACCTGCGCGTCTCATCATGAGCACTTGACGCCGCTACAAATCCCCCCCGCAC
ACGCGTAGAGGCACGCGCACGCACACACGCCTTGCACCCACACCTGGTGCACACACGCACATGCACACGCAGCACCCTCTAACATAGCATGCACTGCTTG
GTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTACTCGCTGCGCTCGAGGGGGAATGGTGACTCTCAACAATTACCGCTAT
GCAAAGTGACAAATGTATTTCTTTCGTAAAATATGCATTCACACGAAGTCACTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTA
CACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGATCTTGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAA
AAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGACAGTCTGGATAGGAAACTGCCTGC
GTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGT
GGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGACGCGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATC
CCCTTCTTTAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTG
AGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTAAGGATGGTGCG
ACTCGCAAAGTACTCGTCTGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGACGG
ATCCCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTC
TCCCCTCTCCACCCTCCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGAGGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACG
CACCTTCTGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCGCCACCGGGAGAATTTGCCTCCGT
GAAACCTGAAACTCGACCACGTATGGGAATGAAAAGAAACGTTGTTAAAGGCGGTTTATTTTGTCCAATCAGCATCAGTGATTTTAGTCCGCTAGTTCCG
ATGTGGTGTAGTCCACACTACGCATTATAATAGCCAATCGCGCAGAGGCTCCACTATATCGCCAATGAGAGGGCTCGAATTATAGTATTGGCGAATGGGA
GGGCCGCCTTCGCTGCGCTCGGCAGCTATTTATAGCCAACGGAAAGTCCGGATTTGCGTTACGCTCGGGGTGCGTACGGAATGACGGACAGACGGACAGG
TTACTCTGTTACTTGTAGGGGACTAGCCGAGCGCCGCCCGCGTTGCGGGCGGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCT
TCACTACTATTTTTTACTATGACAGGGTTATGTTTTATCTCAGTATATTTTACAGTAGACTTGTATCAAAACCCTAAGCCCGCTACGGCTCGCAAGCTTC
GCCTTCGCTTGTCTACCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCT