Description :
From Genome Similarity Track
Location :
contig_187:11199- 12203
Transcript NameFunction/comments
g14661.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
AGGAACTGGAAGGACGGATCGTGCTGTTTGAAGCGCTGGCATCGAAGTTGGATGAAATAGCAGTCGAGCACGGTGTCAATCTCGGCATCTCCTGGAGCAA
GCACTCGTGGTCGATGCAGCCAGACCTATCGTACCCAGACGTGTCGACTCATGCGTTCCGCTATGTGAAATCGCAGCGCAAAGGCATAAGGGGCTGCTCA
AGAGGCAAATCGAGGAAGCGGTCGAGAAGCTGCGTCCGATGCAACCCGAAATTGACACGTTCGTACGGGATTTCAAGACCCGTGCCGCTCGTCTGAGCGA
CAGCTCAACACGCAGCTCCGTGACCTTCGCTGACGAAGAGGAGAAGGATGCTTTGGAAGACCATGGACTTGAAACGACTGCTGAAGACGAAGATATTGCT
AGCACTGAGGCAACACCTTCGGTGGGGACGACTGACTGCGTCAGTTCAACATCGCGGAAGCGCAAACAAGCACATAAGGTAGCAGAGCTACCCGACACCT
TCGGTGTCTATCCCCCAGCACATCGTTCAAAGCGCACGAAGGCTCCCGCGACGACAACACCTCCCGCAACGACACACCTCCCGCGACGACACCTCCCGCA
ACGACAACGCCTTCCGCAACGACGACACCTCCCGCGACGACACCTCCCGCGATGACACCTCCCGCGACGGTCGAAAGCCTACAGTTCCACTTTCCGTGGC
CGATGCACTGGCGAAGATCAAAAAAGAATTCCCCCAGTACGTTAAGATGACTGCGGAGGAGTTGGTGAATTTTCAGAATCTGCTGGTTAATGGACAGCGT
GCACCATCGGAGGAGGAGCTGCAGACGTTCAAGGCGGAGGCCGTCACGAACAGAAAGAAGGGCAAGTTCGTCAACGTTACGAAGGACGTCTTCATGCGCA
TGGTGTCACTGGTATTCAGCACTAATCTACTGATCGAAATCATCGCGGACATTTCAGGAGTGGAGGTGAAGACCGTTCAAACTTACACTGGACGCCTGCG
AGTG