Description :
From Genome Similarity Track
Location :
Scaffold_158:11194- 12861
Sequence
1667 bases(100 bases per row)
TGTACCCTTAATAGGGTGACCATAATGATTACGCCATGGATCCGGTGGATCTGAAGATAATACAGCTGGAATGATGGGTCAAGGGAAGAAGGGACATGCA
GCCGAGCCTGGTAAGGGATTTAACAAGTGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATATGCATAAGTAACAGTACAGAACCTCTTTTGCACCATA
GCACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAGCT
GTATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTTTTTTAACTTGTACAGATCCGACAGGTTAACCGGATTTACTACTTGGTCGGTTACACCC
TAGAGGCTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGATGGATATGGGATATACTAAATAAGAGTGGATCGACGTGTAGATC
CTGTGAACGAATGATGGTAGGTGCCCTCTGAAGGTGGATCTAGTAGATACGGCTAACGAGAAGTCAGGATCCACCGCGAGGTACCCCGGATCCCATACTT
CCGAGTTCAGGTCCAAGGAGGGAGGATCCCGCATAGAAGGACCTGGATCCAGGGTACAGGGATGAGGGATGCAGTGGATCTGGAACTTTCGTGGGACAAT
GGAGACCACAATGGCGGTTGCAAGATGATGTTGGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACAATTACAGTGAGGTGGATCCAAGCGACCTGGA
TCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAA
GGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAATCGAGGCAGGTATAGGCTTAAATATCAATACAGTCCTCAAT
TTGCACAGTAGCACACAAGTGCCTTCCCGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGTGAAGGTTAGGAATTGCGAATCTAGTGTTGGT
AGCGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTCCTATACACGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGG
TTACACCCTAGAGGTTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAA
CCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACT
GCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCAAGCGAGCAAGATCCCGCCCTACCGACGG
GTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTC