Description :
From Genome Similarity Track
Location :
scaffold_6:111923- 116623
Transcript NameFunction/comments
g1894.t1hypothetical protein

Sequence
4700 bases(100 bases per row)
GCGGTGGAGCTAGCGACATCATGTCGTAGCGGTCGTCCACCATGCTGTGCAGTAGCACGTATCGCTCCCGTCCGACACCGCGTGAGTTGTTGTTGGCCTC
GGGCGTGAGAGAAAGCACCTCTTCCATTGTGTACTTGAGCTGCTTCCGATACCGTGGGTTGTTGGCGCAAACCGAGTCGATCGCAGCGCGTCCCTCTTCC
ATCAACGCCGACGACATCTCCCGCACCAGCGCAAACGGCAGGTCCACCGAGAGCACCTTCATGGCCTCGTCCCCGCGAGACGAAAAGCTGGACGAGATCC
ACTTGGACACGCGACGCGTGACCTTCTGCGTGTCAAGCTGGTAGTTCCGGTAGTTCCTGTCCCTCGACTGGTACTTGGCATCGACCACCCGAACGTCGAA
GATGGGCTGCAACGAGCTGCTACCTGACGACGAATTGCCGCCGCCACCACCGCTGTTGTTGCTGTTCATACCATCGCCAAAGTGGTTATTGCCACGGCCA
CCACTAGCAGCAGCGTCGCCATGCGAGGTCTTGCCAGACGTTGTCAGCAGCTCGCTGATGTACTCGGGCAGCGACGTCACATTCGTCACCACATCCGCTT
CCGAGTGGCTTTTCACAGCTCGAATCTTCACTTGCTGCTTCTCTTTCATCATGTGCTTCTGTACGATTACCATCCACTGCACATTCTGCTGCGCGCAGTA
GTCTTCGAGGTCCTCCAGGTGCAGCGGCTCTGGATGCAGGTAATCTGCGCCGATGCCCTGCTCCCACAGCAGCATCGCGATCTGCATCCGGAACAGCATC
GTGTCCGACGCCTTGCCAGCCGAGCAAATCAAGACCTTGCGGCCGCCCGTCAGCACCTCCGACGCTGGTGGTTTGGATTCCAACAGCGCTGAGCTCATGG
ATTCAGCGACCAGCGACACGATCTTATCGATAGCGAAGCGCACGCCCATTGCAGCGACCGACGAGGCTTTTGCGTATGCTGTTGTGAGCTTGAAGCGCGA
CACCAGCGCATCGTAGCGTCCACCCTCCGCGATGATGATCTGGTTGTCGGTCGTCGCGACCAGCAATGAGGCTGATGTATCACCAGTGGTGCCGCCATAC
GCGGCCTCCCCGAGCAAAATTGCCTGGAAGATAAAGCCTGACGTGTACCGCTCGGGACGCGGACTCAGCCCCAAGTCTAAGCGTGTGCACACGGGGCCCG
ACAACTGAAGGAACTGCATGCCCTGCAACAACAAGCGCAGAGAAGTAATGCCCTCGTTGACATCCTTGACAATACGTCGCAACTGCGCATCGCGCTTCTG
AATTTGCTTGCGGCCCACTGAAGATGCCGAACTTGGATCACTGTCAGACAATGAATCTCGGTTTGCAAGCGCCCGATTCTTTGCAAACAGCTTCTGCACC
TCCAACTCAATCATGTCGAGCGACGTCAAGCAGTCCTCTGGTAACAGGAAAAAGGGTTTCAGCGCTTCGATGGCACCTGCCGGTGCTCCATAGTGCTTCA
TCCGCTTCGCGACAAATTTCCAACGACCTGGCTTCAGGCTTGGAGTCTGAGTGGACGGTGGGCCAGCGTGCACGTAGAAAGAAACCTCGTTCGAGAGCAG
TCGTAGCACCTCGCGACGAGCGCTAGTGGGAACGCGACAGAGGTCAAGGATGCCACGCGTCACTCGGGCGTCATTGAATCGCATGTAGTAGGATCCTAGA
CAGCTCGGCAGCGCTTTGATCACGCCTGACACGACTTCCAAGCCTTCTAGCTCCAAGAAACGGAAAGACCCTCCATCATCCCAAATGATGTCGAAGTCAG
ACTCGGTGAATTCGCGCGGGTGACCACCCCCGACGCCTTTCCGGTAAACGCGGTCGAATTGGAAGCATTTCAGTCGCGATACGTTGTGTCGAGCCACGAA
GCGAGCAAGTCTCTCGGTCAGATCAAATGGAAGCGATACGGACACACCATTGCCATCCAGCATCAACGATGCGTTGGGCGCAGCGTTAAGAGTGATGCCG
TTAAAGCTCTCTGACAGACGTGGCATGAGTAGCGGCGTTGACATTTCAACGGCTCCATGACGCTCGAACACTTTCTGTAAGCACACCGATATTTGGTTCA
GAATTAAAATACAGTTGTCTACCAACTCAGCAAAGCACTAAAAGGATAACTGCTTACCTGTAGCACGTTCCGGACGTACGTTTTCGTGCGCAATTGGGTC
TCGTAGATGCGCATTTTGACCGACTCCAGGTGATCGTAGGTGTAGTCGACGTGATTAACTGGTTCCTGTGATACCAGCGCGTCAATGAGCTGCCCGAAAA
ACTTACCTTGCGGGTTTGCGAGAGTTTCCAGTGCCTCGCGAAGGTAGGATCCTTCCACCTCTATCTTCGCGGGCAACAATGGGCTTGCCAGCAGTTCCTT
CGCATTTGGCCGCTTAGAAGGATCACGCTCGCAAAGCCACAGTATGATCTTTTTTACATCTTCAGACTCGCTGAAAGCCGCCGGTAGCTCATGCCTTTCC
CTCAAACCAGTGAGCGCCTGCGCACGCTCCATCAGCGTGGTGAATGGTGGTGACCACATTTCGAAAAACAGGATTCCGAGCGAGAACAAGTCTGCTTTCT
GGTTGTACCGTTGGCCCTCTCTTTCTTGTTCAGGTGCTCGGTAGAACGCCGTGCCGACTCCAGCGGTAATACTGCCATCGACCACATCGGCCGACATCGT
AGTCATCAGATTACTGTCGTGCTGTACACTCGATCGACCGACGACTCGTGTACTCTCCAAGTTCTCCAGCTTCAGCCGCCCGTAGAGCTCGGCAGCAGAT
GACCCGGTTGACTCGGATAATATCGCACCAGTCGCAGTTTCGTTTGGTGGAGAGGAATCCTCGTTGCTGCCGTCATCGTCCATAGCTTTAGGAGGCCGAA
CTGCGAGGCCAAAATCTCCCAGCTTCACAGTTCCTTCAGAGTCCAGGAAAACGTTGGGCGGCTTGATGTCACGGTGAATAATACCTTGCCGATGAATGTA
CACGAGGGCCTCCAGGATCTGTCGGAACATCGTCCAGATCTTATCGGGGTCTTTCCACAGTGCTCCTTTATCAATCACCTCTCTGAGAGCATTGCCCTCG
CAGTACTCCATCTGAATGTACAGTTTCTCAAACTTGCGCTTTCTCTCAGGAGTAGGAGTTCTATGGGGAAGCGCCTTGCGATGGTAGTCGCTACCTTCAT
CGTCGCTGGAGTCGTCCACATCTTCCATTGGAGCTTCTTCCAAAGCTTCCCAGTCGAAGCCATCATCTGGATAGCTCTCCGACTCAAAGCGATGCGAAGA
GAGTTGGAATGAATGGCTATTACTTCGTAGGCTGCGGCTTTCATGGCGAGACGTCGGCCATAGCCCTGTGCTGCTGCCCATTGTGCCTAACCAGTCGTCT
TCGTCCTCGTCTGTGGACGTCATGGCCCCCAATCCGTCTTCAACGCCAAACGAAAGGCTTGCGTCACCATACAAGTCTTCCTTCTCGCTTACGATGGCGC
CACTCATGATACCCTCTTCGTCGCTTAAATCGCTGTCCTCAAGACTCGAGTCCTCTTCGTCGTCGCTAGACATTCCACTTTCACCTTCAATCCACGCCTG
GAAATACCGCACAATGTGGCGGTGCTGCATTCGGGAAATCGTCTTCACCTCGCGCAAGATCTTCTTCTTCATGGCTTTATCGTCCGGGTCCAGCTTCACT
TTCTTCACCGCGTAAAGCTGTCTGTCCAGGCGGTTCCGCACCTTCACCACTTCGCCTCCTCCTCCGCGTCCCAGCAGCCCCAGCTCTTTAAAATCGCCGT
GATATCTCGAGTGATATCGTTCTGCAGCTGCAGCCGCATCCAAATCGGACGTATCCGAGTCCGAGTCGGACAGACTCGACGAGCTGCCGTCGCGCCTTGA
GCTCGCCTCCGTCTGCTGCTCGTAGATGCTCGACAGACTCTCTCCATCGCTGCCACTGTACTCTCCGTCAATACTCGACCGATGTCTCCGCCTTCTCCGC
CGTGTCTTCTTGATCGTCTCTCGTTTCTTCCTCTCGGCGTCGATCAGCGCGATAATCTCCTCGTTCTTCGCGCGCGCCTGCGCCTCCTGCTCTTGCAGCA
GCGCGTCCTCCTCCTGCTTTTCCCTCGTCTCTCGGTCCTGCTGCCGGGTCATCATCTGGTCGAAGAACGACGACTGGTCCTTCAGGTGTTCCTGGATGAA
GTCGGTGGCGAACACCACGAGGTCGTACACGACGGCGTCCCCGACCTTCTCCAGGGCGAGCGCCTCCATCCCGCGCTGCAGCTTCTGCGTCTCTGTGTCC
GACAGCCCGTGCTTGGGCTCCACCGTGATGTTGGGTGGCTGCTGGAGCGGGTACGCGCGCGCCAAGTCGAAGTGCAGCAGCACTTCGGCCGTCGTGGCCG
AGCCCGGCGTGGCTTCGCACGCCAACCGGATGGCGAAGATATACGTATAGAGCGGCGTGGCACTCTGACTCACGAGGTCCCGGTCGAATATGGCCTGCAG
CACCTCCAGTTCCTGGGCCTGCAGCTCGCGCGCCTCGGCGAGCGTAGCGGCATCATACGTAGCGGGTGCATCTTGGACGCACGCGTCTGCAGAGCGGAAA
ACGGAGCATCCCAGGTGGACATTTAGCTTGTTAGCTGCAAGAGACGTAGGTGCACACACCTACCTCTCTTCTTCCCCTTCTTGCGGCCCATGGACCGGTA