Description :
From Genome Similarity Track
Location :
contig_7:111918- 114195
Transcript NameFunction/comments
g2003.t1hypothetical protein

Sequence
2277 bases(100 bases per row)
CCATTGAGATAGAACGCGGTGAACCCCGTCGACGTGTGCATCACGTTGTAGAGTGCAAACTCAACCATCGGCAAACTGGCCGACCTTGTGTGGGGAGATT
CCGCACAGACACTGCGCAGAGTGTCTTCGAGCACGCGATTGACGCGCTCTGTCTGGCCGTCCGTCTGCGGGTGGTCGGCCGTGGACAGGAGCAGCCGCGT
TCCAAGCAGTTGGGACAGCGTTTTCCAAAACGCAGACGTGAACCTTGGGTCACAGTCAGACACAATAATCTCCGGGAGGGCATGATAGCGGAAGATGCCA
TCGAGGAACAGCCTTGTGGTCTGTTCCCCGGTGACTGAGTCAGCCACCGGAGCAAGATAGTACATCTTGCACAAACGACAGACAAACACCAGGACGCCGG
TATTGCCCTGGGCATCAGCCGGCAGTCCAAAGACGAAGTCGAGACTCATTGACTTCCAGTAGTCTGCAGAGACTGGCAGACTCTGTAAAGGAGCCAAGGC
ATGACCAGCAGGTTTCACACATTGGAATGTCTCACAGGTCTTCACATACGTGGCGACCCACTTATACATGTGGGCCACCAGGATACCTGGGAGACCGGCA
AGAAGATCTTCTCGCGGCCAAGGTGGCCGCTGGAAGGCGCATCGTACGCCTCCTGAAGTATGTCATACTTCAAATTCTCGTCATTGGGGATGACTATCTG
CGGAGGATCGGCCGGGTCCACGCGATAGTGGAGAAGGCCATCGACCCACGCATAGAGATGGAGTCAGGAGCGTTGTCGAGGAGTTAGTATCGCAGGCTTG
GCCTTCTTGCCAGCGGTAAAGAACCGCGCGATGGGTGAGAGATTATCATCATCTCGATACGCAAGGCGTATCCGATCGTACAGATTTGTCGTGACCCGAC
TAATGTGCGGAAGATCATAGTCGGGTTGCCGTGGCAGCGCGTCAGCAAGCAGGTTCAGCTTGCCCGGCTTGTATTCCACGCGGAAGTTGTAGTCCGCCAA
GAATAACAGCCAGCGGGTCATCCTCTGAGACAGATGCGGAGAGCTGGTGGTTGTCCTCAAGGACGCGTGGTCTATTAAGATCACGAAGGGTTCAGTGTAC
CCGGAACTTAACAAGGGCGTACTTTATAGCGGGGAGCTCCTTATGATGAACAGGGTAGTTCCTCTCGGCGGCCTTTAGCTGCCTGGACTGAAACGAGATG
ACTCGTTCGTGCCCGTCCGCGTCGTACAACAGCAGCGCGCAACCAATGGCATAGTCTGAGGCGTCACAGACAGCGCTGATATACATTGTCTCGTCCGGTA
AGGCCAAGCCCGGCGCGCACTGCAAGTTCGTCTTGATGCTTGACCGCATTCTGATGATGGCTTTCCCAGGGCCACTCGACATCCATCTTGCGGAGACCCG
ACAGGGGTCGTGCCAGCCTGACATACCCCGCTCTATACTTGTGCAGCTTGTTGGCTAGGCCTAACCACTTACGGAGATCCTTTTGCGTCTTGCCATCTTC
GGCATGGCTATGGATGAAGATATCGTCAAAGTACGTCTGCGTGAACACACGCAAGGGTCTGAACAATTGTGTGACCAAGCGATTGAAAGTCGCTGGGCCA
TTTGATAGACCCCGTGTCATCACTAACTATTTCCAGAGCATGTCGCTCGGGATGCTCACCGCTGTGAACGGGATGTCGCGCTCGAGCATCAGGATCCGGT
AGTACCCATCCACCAGATCCAGCGCACTATAAAGCTCGCAGTCCGCCATGTTGTCAACAACACTTCCTTGCGAGGGATGAGTGTCTGAGCGGGCTGCTCA
GCTTGTTATAAGCATGAACCAGACGTCACTTCCCGTTCGGCTTGCGAAGGCAGAAGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACTATGCCTGC
CTTTGCTTTCGCGCGAAGAAGACATCAACGACCTTGCACTGTTCGCGAGGCAGTGACCATTGTCTGGTCACACCACACATTACTTTGTGCCTAAATCCAC
GGTCAGGTGGGAGTTGGGACGGCGGATCCTTGGACCCTACGTCCGATAAACCCTTCATCAACGGATACACTAAATTATTGGGGCTCTTGAGGATTGCAGA
GCCCACGCGTGTCGCGCACTTCTTGCGGAGTTCGTCCAGGACGTTCTCGTTCATAACCGAAGAGGAGTTCAACTCTTCTGGAGAGACCTCCGGCTTCAGG
AGCACCATCTCCGCGATTGCCCCGGCCTTCAATTGTGCCAGGAAATCGTCCATCGACATCTCTTTGATGTTCAAAAG