Description :
From Genome Similarity Track
Location :
Scaffold_61:111911- 116996
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16962hypothetical protein

Sequence
5085 bases(100 bases per row)
TGGTTATGAGCCCAACGCTCTCGCTGTTGAAGCACTACAACTAAGGAGCGATGGCTGAAGCAAAGAAAGAAGTGAAGGAGTCGAAGCACGAGACGAAGGC
CATCCCGCTGTTCGACGGCAACGACTTTGAGATGTGGCAAGAGCGAGTCAAACTGAAGTTGATGCGCAAACAACTTTGGAAATACTGCGTCGAATATGTC
AAAGAACCATCAGAGAAGAATAAGGAATCGGAGCACAACGACTGGGTGATCAAGACGGCTCGAACCAAGGAGATCCTGTACGAGTCCATGACGAACCAGA
TAATGAAGACAGTGAAGTATGAGCAGACTCCGTATCGAGTGATGGAGCGCCTGAAACGGCGCTTTATGGGGAAGACCTACTTGAAGTTTGCTGAGGAGAA
AGTGAAGTTGAGTCGTCTTCGACTTGAGCCGAAGGGAAATCTGCCCGATCATCTGAGTGAGATGCGACGAATCATGGAGACTATTTCGGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCAGCATTAAAAGTCGCTATAATAATGAGAGTGATGATAGCGCCTACGTCATTATGCC
TTTGATGAAATTGGAGAAAAAGGTACTGGATCTCGCACGTGATCGATGGTACTTGGATTCTGGAGCTACCAGTCATACGACGAACCAAAATGTTGGTTTC
GTGTCATTTACCCCGATCAAATCAATGGTACGGACAGGTGGAGAAAATTGACTAGAAGTTGTTGGCATTGGTGATGTGAAATTGGATTTGTTCACTCCAA
CGGGAAGATATTGTGTGTTGTTGCGTGGAGTGCGGTATGTTCCTGAGTTACAATGCAGTTTGTTCTCTGTAGGAAGGCAGGCTTCTCGTTCTCTAGCACC
TGCAGAACGAATTCGATGTCACATTGACGAAGAGGAATATGCAGATGCGATACTACACACGCAAAATGTGAAGGCGTATAAGGATGAAACAGGGCTCTAT
CGTCTGCAGCTGAAGAGTTCAGGAGAAACTGCCATGGTGGTTGCTGAAGCAGTACAGAATGTGGAGTTATGGCATAATCGATTTGGACATCCAGGGCGAA
ATGCGTTCAACGCATTGTTTAGCCATGCCCGCTGGCCATTGACGAAACTTGATCTGCGTCAAAACGATGAGTTTCAGTGTGAAACTTGTGTGAAAGGAAA
GCTGAGCAGGAAAAGCTTTCGAGTGCGTGCAAATACACCGCCTCGTGAGTGGCTAGTCGGTGAATGCACTCATTCAGACATCTGGGGGCCTTATGCAGTG
GACTAATACTCTGGAAAACGCTACTTTGTCCTATTCATTGACGAAGCAAGTCGTTTTGTGACGTTGTTTGTGCTTGCAGAGAGGTCGGAGATCTACGAGA
AGTTCGAGTTGTACTATGAATTTGTGAAAACGCAACTCAATGTCCGCATGAAAGAATTTCGAATGGATAATGCTCTGGAGTATGTGAAGCTAAGTGGCAT
TTGCAAGAAGAAGTATGGGATGACGTGCACACCGTCGATTAAGCACACACCAGAGCAGAACGGTGTTGCTGAAAGAATGGTGAGAACCATAACTGAACGA
ATGCGATGTCTGTTGAACCACTTTAAGCTACCCCAAGAATTGTGGGCAGAGGCAGCAGTAACGGCAGCTTATTGTGTGAACATAATGCCAAATTCAACAA
GAGACATGGAAATACCTCACGCGATATGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
ACCAACAGAGAAACAGGGAGAAAGAATTCATTCTTGAAATACATCGAGTGACCAACAAGTGACTTCTTCGTCTTCTTCTTCTTGT