Description :
From Genome Similarity Track
Location :
Scaffold_904:11190- 12466
Transcript NameFunction/comments
g11705.t1hypothetical protein

Sequence
1276 bases(100 bases per row)
CTCAGCTCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGGCTCTCTGCCGCCTTGAAGCGCGTCGCCGCGCTCGAGGGCGC
TTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTTAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCA
GTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTCGCTCCGAAATCGGAAACTGCATGTTTAGCTAG
GTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTAAATTCATTTGTGTTTCCTCTGCCGGTATTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCT
GCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGGTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCG
CAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTGAAGTGTCTACGCCCGTCGTAGACACTGTGTTGTCGTTGCCATGACTGCGCGCAGTAAATCG
TCACAGCTGATACATTGCTCGCATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTACGGAAGGAGCTACCGCACCGAGTAC
GCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGATAAG
CAGTCGCTCCATTGACGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGACCCG
CAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTGAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCAT
ACCATGGTGTCGAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGG
TCACCAAAGACCACAATACCAGTCCTCTGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGGGTCGGTA
GTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCG