Description :
From Genome Similarity Track
Location :
scaffold_1027:1119- 3919
Sequence
2800 bases(100 bases per row)
GAATCTTCAAGGGACGTACGCATTGGCTTCAACTGGCTTGCTGTCCCACATTCTTCGTCATTTCTAGATTCTCCCCCTCAAGCCACGATCGAAATGAAGT
GCGCAAAGAGTGGCTGTTCCTGGAGTAACTTTAAGGATACGTTTCCTTGCAGTGTTTGTGCTTTGCCGGTGCATCACTTATGTAGTAACGAGCTTTGTAC
CAACGCAGAACTCTCGAAAAGGTGAGTAATTCGTTTTGCGTTATCGATAAACGCTAACACAAAAGTACAGGTTTTGCAGCCGCAGATGCGTCAAGAAGCT
CTTCGAAAACAGCGACTTGGCCCCGGACAGCATGACAAGAACGCCGAGTAGTATGTCTGGTATCTCGGCATCAAGCCAGGCCACAGTGATCGACCTCAGA
CACGCAGACGAAGAAGAGAAGGCGGAGACAAACGTAGAGAAGGGGGAGAAGACGGAAGCGGAGGTGGTAAACGTCATCCCAAAGGAGATTGTCCGCGGAC
CTGAAGCAAACGACTTCATCTGGAAATTGATCCACAAGCTCGAGCAAAAGGTGTTATACAAAGGCAAAGTGTTCACTCATATTTGTCTCGAGTGCTTGAA
GACAAAGACATGGAGAGAATCACTGTGTAAATGTCGGCACACATCGATCGCTAAGGCTCACTTGGTATCCAAGCACAAAGACCTCGAGGAAGCATCCAAG
GAACAACAGCACCGGCTGCAACGAGCAGGTCGCTTCACGGTGAAGCCGCCTACTGCGATGTCAGACCCCGTGGCTGGAGAGAAGCGGAAACGCTCAACGG
AGACTGAAGCCCCACGTGTCAAGCGAAACAAATCATTTTGGACGCCACAAGTGAATCAAGACGGAGTCACCGCCCATGTCGCTCACTGGTTGATTCGTGA
TGGTGGGTACTACTTTAAACTTTGATAGCTATGACAGTGTTACTAACATGCTTCCCAGACTTGCCGTACAACATGATCACTACATCGGCCTTCCGTGAGT
TCCTGGCTGGAACTACAGGAAACCCTGACGTGACTGTGCCTCGCATCAGACTTATAATAACATTCTGGACAGCACTTATGATTCGTTTGGAGACAAATGG
CACGCTTCACGATATCGGACACAGCATCAGCCGCTCGCAAGGTTTCTAAGCAGTTTGACTCCACCTTGCAAACCGACTGTTCGATGCATGCGCTTAATCT
ATGTATCGACTACGGGATTAGCTTGAAAGAGAATGTGCGCAACATGTACACACCAGACCCGAACGACAAGAAGGGAAAGTGTGTACCAAGAAGAAAGTCG
TGGTAACTGAAGGAGGTGCTTTCCCCGAAGGTGGTGCTGTTATCCGGAAACTTCGTGCACTCAACAATTTCTTTGCGTCGAGCCGGTCACCTGAACGGAT
CGCGAAACTCGAGGAAGTTCAAGCGTTCTACAAATTCCCAAAGCTGGCCGCCATGGTAGACATTGACGCGCGCGTTGCTTCGACTGTCAAATTGTTCAGG
CGTTCAATTATCAACTACCCTGCATTCAATGCGTTTTCCAGAGGGCAGACTTGACGGAATCTGAAAAAGCCGTGTTCACCAGCATTACAATGGCGGAATG
GGAGCTGGTGGTTGAACTAGAGACAGTCGTGCAGCGGATAGCGGACCTTGCACTGGTGGCGCCGCAATCCGCGACTATGGTGTCATCTACGATGTACGTA
TTACTGCGGGTTGCTTCTGCTCGGATGAATTCCTTCAAATTTTCGGCATATTCGCTACACGTACCCGCAATGCAGACACGAACGAGAAAAGTTTTGCCCG
TCATCAGATCACACTGCCGGATTTAAGTGTTTTGGCGCAACGATGTATCAAGCGGACGTTACATCAAATAAAATTCTGGCTTCCACAGCCAGGGGTGCCA
ATGGGCATGGATGGCCCTGTTACTTGACCCACGAACAAAAAGCGCTGCAAAATTATCTTCAGATACCGGACTGTGCGGAAGCGGCGACGGGTCATATTCT
GGAGGACACGAAAGCGTTGCTTCGCGCTGAGCATCGAGTCATGTACAAGGCTCTTCATATGAACGACGTCGCAGAAGGAGATGCGGTGAACTCAGCAGTA
AGTTCGCCTGGTGGTGACTGCAGTAGCGGCTCTGACACGGAGTTAGATCTCCTATGCGGCGAAGAGGTGTCGGAGCCAGTCGACATGACACCAACTGATG
TTTCACTCAACGCAAAGGCTGATGCTGTGATGGAGCAGTGGCTAGCCCTTCGCATCGACTGGGAGAAAGTGGTGAAGGGTCAAATCCCAGACCAGGAGGA
GTGTGATCGACCTACCGAAGCTGACCATACGCAACAAGAAAGAAGGGAACGTCCGGGTGTGGAATGTGGGGCAGCTCTGTCAGCAGGTCGACGTCTGTCG
ATGGTTTGCCGACGTCGGGCAAAGCCGGTTTCCGTCTGTGGCGAAACTTGCGCGCGTCTGGCTGGGACGTAGCTGCTCGACTGCCTTTCAAGAGCGCGTT
TTCTCAACGGCAACTCTGGTTATGAAATCACTCCGTACTTCCACGGATAATGAGCGCGCTCAGCGGCAGTTGATAATGCGGCACAACCGCGAAGAGATGA
AACGCATGGACGAAACGAAGCACCGTATTTGGTAGCCATCTATTCTACTATCCGATAGTAACTTTACTATTACTTTTACGATTACTATTTGTTGTGGGTC
AAATTTTAGTATTTACTATTGATATTGCTATTCCCTGCTGACTCGGGTAGTAGAATAGCACCACTACTATCGCCGAAAATCTCACTACTACCGGGCCCTG