Description :
From Genome Similarity Track
Location :
Scaffold_679:11189- 13469
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_679-fgenesh-gene-0.4Vacuolar iron family transporter
Pytve_DAOMBR484maker-pve_contig_679-fgenesh-gene-0.1H-SHIPPO 1

Sequence
2280 bases(100 bases per row)
AGGACGCCTTGATGTCGGCCATGAGGCTGGACGAGGAACTGGGAGCCGTGGAGCTGCTTGGCGCCACGCCCGCCGTGCCGTAGCTCTTGTGGCCCGCCGG
GCTCAGCTTGCCGTTGCTGGCGCTCATGGCTCTCGCAGAGAAGATTCCAAACTGGGGGAAATGAGTCGCGGAGCGGAGCAGCGGCAGTGGAGCCGACCGA
CTTGCGGGGCTGCCGAGCAACGCAGCGCCAAAGATCCCCAAACCAGGTGCACAGCTCGAAGGAAGAGCGAACGTGCGCCGGTTAGAAATACGGGTAGAAA
TACGGGTAGAAACGCGTTCTTCCAAGTCCAGCGTGGCGCGCGACAGGCGGCAGGAGGAGGAGGCTCTTGAGGTTTTGTGTGCTGTGCCAATTGAAGCGCG
CGATCCTCTTTCTTGCTCAGCTTTCCACGGCCAGTTTGGGTCTTCTTGCAGGTGCGCCTGCGTCATGAGACCGGCCGGCCGCTCCTGCCCAATCGTCCCG
GAAGACGAGGCACGGCGGGTTCAGCTGCTCAGTTTTCATCACTCGTCGGGCTGTGGCCAGTTGTGTGCCAGTGCGAATTGGTGCTCTAACACCGCGTGAT
GCACTGGCTGTGGCTGGGTCATTTTGTCGTTGGGTTCCACCGACGAGTGTTGATGCCGGCCCCTGACTGAATGGTTGTCAGCGGTGTCCTGAACGCCTTA
TTCCGCGGCCATGACGCCGCCGTGCGTGGCGCCGGCACACGTCTCTGTCAAATGTATGGGGGTTGTGAAGGCGAAGCGACCCAGAGCCAGATCGAGCGCC
AGCTAGTCGCCGATAGAAACACGCCCCCCAACGGCAATGCCACGTGCGGCGCGCGGTGGAAGCTCGCGCGTGGCGTTCGCCCCAACGTGCGTATCCAAGC
CGCACACCGGTTAGGGTCGTTTCTAAATCGAACCTGATTGGCTGCAGCCAATCGGGAGCCTCGGAATGTAAAACGCTTAGAAAACTCATATTTCTAAGCG
TGCGCAAACGGGACGCGAGTGCGGAACCGTCCGTTTGACGGTGCGCGGCTCGTTTGTTCCCCCGCTTCCGTCAACCCTAGCCAGTCCCCCCTCCCTCTTG
ACAGAGCAGGAGGACATGGATGTCGAGATTTGCCCCTATTGACGCGCACTCTTGGTCAGAATGCACGTCCTCCGCTTATCGCGTCAGCCACGGTGCTGAC
CGCATGCTACGTTCCGGTGGTTGCGCACCGCGCGATTGGCTCGGCGCGCTCGGAGGCACACGCCCGTCGGACCAATGCGGCCCATCCCTCGCCCAATGTC
CGCCGCCGCCTTCGTCCGCCGTACGTGGCGATGACGGCNNNNNNNNNNNNNNNNNNNNNNNNNCATGGCTCCCTGCCTGCGTCCTCCCTCCGTCGCGGCC
GAGCGCTCGCCAGGACCGCAGGACAGCGCCGCTCGATCGCTAACTTTAGCCACCGGCGATGACGTCCCGCGGGATGATCGAGCCATTTCCCAGCGCTATT
GATAGCCTCTCGCCGCCGTTCTCGGCGCTCTGAGCGCCGGCGCGGCCGAAGGAAGACGTGGAGACCCTGACGGCCAAGTAAGTCTGCAAACCTCCGACTC
GGGCACACCTCGCCCTCCGTTCGCCCGCTCCAGCTCGCTTCCTCCAGCCCGCCTGCCAGCCATGAGCCCGTCGCCGCCGCGCGCCTCGACGTCGCCGGGC
AAGGCCAAGGCGCCGGGCAGTCCCGTGCCGCTCGGTACGAGCTTCGCGGACGTCAAGTCGGCCTGCGGCGACCAGGTCGACTCGCGCAAGGTTACGGCCC
CCTACACGGTGTTCGGCACGAGCTCGCGGCCGCGGACGACGGCGGGAGACAAGTCTCCCGGCCCGGGAGCGTACCAGATCCCGTCGTCGATCGGCAAGCC
GGTGCTCTCGACCATGCACATGGCGCCGGCGTGCTCCATCTCGGGCCGCGAGAAGTTCGGGTCGACGGCCGACCTGAAGGAGTCGGGCAAGTTCCCCGGG
CCGGGAGACTACTCGGCCAAGGTCGTGAACCCGCGCGAGCGGAACGCGCCGAGCTACTCACTCGGCAAGAAGTGGACGGGCGGCGGCAACGGCGTCAAGA
AGACGCCCGGCCCCGGCGCGTACGAGTCGCAGACGACCATCGGCCGCACGGTGCTCTCGACGCAGAAGAGCAACCCGATGCCGGCGTTCACCAAGGTCGA
GCGCAAGCCGCTGCTGGCGACCTCGACGGCCGANNNNNNNNNNNNNNNNNNNNNNNNGGCCCCGGTCAGTACGCGGTCGT