Description :
From Genome Similarity Track
Location :
scaffold_205:11188- 12928
Transcript NameFunction/comments
Pl_107734callose synthase, putative

Sequence
1740 bases(100 bases per row)
AACTCAAACCAGATCTTCCTGATTCTCACTTCCCAATTTCTACTGGAGTTGACACCCAGTCTCCCTTCTCAGAACCAAGTCTCTCATCAAGCATCTATCT
CCTGTCATCATGGCTCGCATCATTCCTGCCGTCTCGATCCTGCTGATGTTGGCGACTGTCCCTGTCGAGGGCTCAACTGGTCGATTCCTTCAGTCCACAC
AAGGCAACTGCGCTCGTCGGGTTTGCACTGCCAATGGTGGTGCCTCAACTTCTGAAGACTGTAACACCCTGTGCAACCGTGTATTTGATAGCAACAGCAT
GTCCGAATGTGGTCAGAGTTGCGTGTGCACCACGGATACTTCTGCCACAGCGCAGATTTGCTCGACGAGTTGTCAATATACTCTGAGTGACTGCTCCAGT
GGCCAGATGTGCAATGGCGAGACAATGGTCTGCCCCGGGTCGACTACATCAACTACCGATTCGACTTCTTCCACCACATCAGGCTCGCCCACAGTGACTA
ACGGCAACACCGCTACTGGGTCATCTACTAACCCAGCGACCGGTTCGACCACAGCTACTGGATCAACTTCAACTACTGCAACGGGATCTACTGCAGCAAA
TGGTGCAAACACTCCTTCTGGGTCAGCTTCGACTACTGCGACTGGATCAACCACGACGGGTGCTACTACCCCGGGATCAACCACAAGTGATACCAATGGA
GCGACCACCGGTACTACGACGGGGTCCTCTAATGGTAGTACGAACGCTGCTGGGTCGACCGCCGGTACTGCATCGGGTTCGTCCGGGAAATCTAACGCTA
CCACAAGTTCGTCGACCAATGGAAACGATGCTAGTAGCTCGTCAACCACAGCGTCTTCTTTTGATGGGTCGTCCTTACAAGCTTCATCCGTGGATGTTGG
TGACTCGTCTACTGGTGGATCTACTGCGTCATCGCTGAGGTCAGACTCCTCATCCTCATCTTCGGGATCGAATCCGAACTCGGCAGTAAAAACGATGCTG
CCGGGAGCGGCGGTTTTAATGACCATCGCAAGTGCGTTTGCTTTCGTTCTGTGCTAAATGCAAGACGTAACCTGGCCATGTCAATACACAATTGCATGTT
TACAAGCACTTCGTAAGTTCACTTTACAGAAATTTCAGGTTGTAGTCGCGGACGTCGTAACTTTCAAAGTCCACGATTGTTGAGTATTCAGTACACATGC
ACTTGCATTTGAAGAGATGACATTATCACTCAAATTTTCTCGCTCCAGGTATATTCTTCGTTGATTTATGAAGTTTATCTTTACAAAAATGAAATGAAAC
TAGATTATTATAAATATGTTCTATGCTGCTGCATCAAAAATCAACGCGAACTTCCAAGGCGACGATAAATCGAAGCTAGAGGATTCAATCGAATTGCATC
GGTCCTCACCGTGTTATAAATTTATTTTAATGAAGAATTTCGCTCTGCTCAAAGCGAGAACAATCGCTCATCTGGTTTTCGGGTACCACCGGGTGTACGC
TCCGCCTCCTTGGACGGGGTCATAGCTGCGCCGTGGTATCCACTCTCGGGTGTCAAGTCCAGTGGACCGACATCACTCTTCGTTCCCATCGGGGCCAAGT
TCTCTTTATATTCCTCTTCGTGTTTCTTCGGAGCTAAGCTCATTTGGTAGTTTTCTTCCTCTTCTTGCTTTTTCTTGCGACTTTGAGCGAATGCGCGAAC
CGAGAGAGCAATGGAGAATAATGTAGCAAGACCACCACCA