Description :
From Genome Similarity Track
Location :
contig_46:111872- 112876
Transcript NameFunction/comments
g10047.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
AAGACGGCCAACTAGAGGTCGACTTCCTCTATGACCGCGAGGCGTTTGCGACGAACGATGAGGCCTACCGACAGGGCAAAATCTCTCGGGTAGGTCTGGA
ACTCCTGATCCGAAACATCACTGAAGTCGCTACGTCCAAGTCTGAACAGGACGATCTCTTTCATGTGGCCATGTACGACTCGGAGGTTCGGCTCACGGCA
GCACAGGCGTACCAGGTTCTTGACGCTTGCCACTACCTCAAGCCCGAAAGCAAGAAGATCGAGACGATTGCACTGCTGCTGCCACAAATGCTGACGGCTA
AGGAAGCGCAGATCCTCGTAGCTCGAACCTTGACGCTCATGCAGCGGTGTCGTCTGAAGGCTCGTATGGGCAGTGCGTACTCCGTCGTGCTCGGGAACCC
GACGTCTCACTACTCGTTCGATCTCGCCAAGCACAAAGACCGCATCGCGTTGACCAAGCTGGCTGAAGTTGCTCAGAGCGAGAAGCTCTTCTCGAAATCG
CGCTCTGGCCGTGCCGACACGTCACAGCACGGCAATTGGGAAAACTTTCGCAACGAAGAGCTCGACGGCCGCAGTATCGTGCTCACCAACACCTTCTTCC
ACTCACTACCACGACGCGGCAAACTCTGCTTTGACTACGTGAGCACACGCGTCCCAAGCGAGGCACCACGCAGATCAGTGAACGACGCTTTGACCAGCTC
ATTGAAATTCTCCAGATGGATGTCGTGCTGCCGGACGCGTTAGGTGCTCTAGGCCCCACGCGATCTCAACGTGCAAGAGGACACCGTCAACCCAAGGCTG
ATGTAAGTGAGTCCAAAGCCGAAAAGGAGGAGAGCGAACAAGTGGCTGAGCTAGCAGGGCCTCTTGCAGCCAAGTTGAAGCGTACAGCCTCCCAGGAGCA
GTCTGCGTTCTGGAACAAGACGCGCGCCTCGATCCTCAAGCGCGGCTGGGACTTTGTCGTGAACCACGCGTACACGTTCCGCCTCACGGGCGCCACCAAG
GAGA