Description :
From Genome Similarity Track
Location :
Scaffold_916:11187- 16341
Transcript NameFunction/comments
Phyta_totarag11339Putative cullin putative
Phyta_totarag11340conserved hypothetical protein
Phyta_totarag11341hypothetical protein

Sequence
5154 bases(100 bases per row)
AGCCAGATCATTCATCATACCTTCCATCTTACCCGTGAATTGAGCACcgcagcgcagcttcagcttacCGATCATAAGCACCTCGGCATCGGCGGAAGCA
GACCGCTGGTTCAGCAGACGCTTGGCCAGCTGATTGCGGTAGATCTCAGCAAACAGATCCTTGTCCGTGAGGTACGAGAACACGAacaccaccttctcca
ggtAGTCCTCCACCTGCTCATCGCTGAGCTTCTCGCCACCAGTCTTAAGAATACGGTCACAGAACGTACTCATCAGCTTCGCCGAGCTATCCGGGCCAAC
ATCCTTGTTAACAAACTCGACGAAAGCCTCCTTCAGAGCCTTCTGGAACAGCGAATTGCCCGCAAACTGCTCGTTTACGATGCTGCGGAACTTGTCGTGG
ATAGCAAGAATATCCTTAATGAACGTCGGATCCGAGCTAGGATCACGCACGTTGCCCGAGGCGACAGCATTAGCGCGCTTAGCCACGATGTCATTACCCA
CTGCCGtaatgtgctgctgcacaaggtCCGCGATCGGCTCCAGTCCGTTCTTAAGACGCGCAAATAGGCGGTACATCCGCGCCAAGTCTTCCAGCTTGTC
GTTCTTGAGCAATGCAATGACACCGGAATTCTCCCTCTCAAtgagctccttctgcgcagcctcaagcagcacactctccagcttcttcacgagctTCGGC
TCCGTGGACTTGTGCAGGTACGTGTGCACACGGTTGCGCTCGCTCTGCAGAGCTTCCTCGACCTTCTGGAGATACACTGGCGTCGAGTCTTCACTGAGCC
AGCCCTTGGACTTGCGCTCGTAGTACGTGGCACTGGTGGTCACGAGGTCAGCCTCCAGACAGCTCTGGTACACGTCGAGGGACTTCATGCCCATGACCTC
GAAGATCTCGACGCAGTTGCGCATGAGCGTCGTGTCGATGATCTCTCCGttgcgctccttctcgatgaGCTCGATCATGGCATCCTTGACGCGCACCTTG
ACCTTCTGGAAGACCATGCGATCGAAGCTCTGCAGCccggcgtcgtccagcgtcggGAGCGAGTGGTGCTTGACGTAGTAGCGGTCCAGGTACATGAAGA
AGCGGGTCATCCATTTCATCATGAGCTTGTGGTTGGTCCAGCGCTTGacgagctcctgcaggaAGAACTCGTCGTGTGCCTGCTCCAGACTGggcagcac
cttcttctccaggtACGTGTCGAACGTCTGGCCGTGGCGGTCGTAGAGCTGCTCCGAGAAGTTGTACGGCGAGCGCTGCGTGCACATGTTGTAGCACGTC
GTGTAGATGGGCATGAAGGCGTTGGGCGGGAAGGGCGACACCTTCACCTGGTCGAAGCCCTTGTCCAggatgtccagcagcacgtcgatGGCCTTGGGCT
TGATCTCCTGGTCCCAGCCATCCTTGAGCGAGATCATGTTCTTCCCACTCATGTTTCGGCAAGATCTTGCTGGTCTCGGGTTAAGAGGAATAAAAACTGG
GCGTGTGAAGGACGAACGACTTGAAAATGGCAGGTCACTTTGCCCCTCTCCCATCTTTTCCCTTTTGGTTGATAAGATCACGGTGGCGAATCCTCTCAGT
AGACATACTTTTTGAATCTATTTCACCTTCATTACAGAATAGTTGTGAAAACGCATAATACTAAATAAATTTAAGGGTTTGTTAATTACCTTGATACAGT
GATATTTAGTAGTTTGTCCTTTGTTTTTATTCTAGATAAGCATATTTTGTACCCAAGTCCAGGTACATCACTGTTTGGTTCCTTTTAAGCCAATCGGTAT
ATTATTTGTACATATCGCCTTCCTATTGGTAGAAAAACTTCCATACAGGAAACGCGACGACTCAGTCACAACCAGCACCAAGCGACGGCGCCTGTCCTTC
CTCCTCCCGCTCGACCGCGCTTCCACCCCGTACCGCAGACCCCAGCGAGCGCGCCCCCCATAATCTCTTCACGCGGTTCCGCGTCATCCACACCCTGTCG
GCCACCAAATCGACTACAAACTGGAGCAACCACGACCGAGTCCCTTCCAGCAGTTCTGTAAGGAGGCTCTCTCTACACTGATACCCACTTAAGCAGACCC
TGTCTCTTCCAGTTAtcatcacttcaacatgctcCGCGACATCATGATGGGGTCGTGGGagttctccacctcctttTGCGTGGGCCGCAGTCGCGGCTGC
GAAGTGAGCATCGCCACGTCCGAGGAGACGCGCACCGTCAGCAAACGCCACGTGGGCATCGTCCCTCTCACAGAGACGCTGGCGATTTCGGCGCGTGTTG
GATATGGCAAGCGACGCTGGCTCGTCTACGACCTGGAGACTATGAACGGTACAGCGGTGAACGGAGTAGAGCTCCCCACGGGAGGCAATCGAGAGCTCCa
tgatggcgacgaggtGGTGTTAGCCTCAGCCATGAGGCAGAGCGTGCGTCTTCTAGTTCAGTTCCCAGACGATGCGCACTCGTGCATTGtggtgaaggcg
ttggcACGTTCCATCACGCCGTCGCCTGCGCCATTGCATCGTCGGACGACGGCTTTGGGGCCGTCCCCACGGCGCTCGCCACGACGAGTTGTAATGACCA
ATGCGTCGGTAGCTGCAACAGGTTTTGGGAGATCGACGGTTACGATTGCTGGCAGCCCGGCGTTTACGAGGACGGGATGTCGATCAGTAGTGGAGACGCC
GGGAAGTGATGTGAACATGATGACTCCGCCGCCGCAGAGTCTTTCGCAGAAGCGGAGTCGCAGCAGTCcgaagaagacagcagtTGAGATTGAGaatgtg
aagaagaacaaacAACAGGATACACCAAATAGTCAGCAGAGGAAACGTTCACGTCGTGATGGTGcgattgaagaagaagcaacagcaactgAAGGTGGTA
CCAGTACTGCTGCTAAAAGAGCTCATGAGCATGAGAAAGAAGAGCGCGAACGGCTCATGATGTGTCCCGTGTGTCTGGAGTACTTTCACGGCAGTGCCAC
GTTGCCCTGCTCGCACACGTTCTGCGGGTACTGCATCAGCAACTGGTTCCGAAACTCGCTGTCGTGCCCCGAGTGCCGTGACGTTGTGAAGACAGTTCCC
GTGCGCAACCGCGCACTGGACGAGCTAGTGGAGCGGTTGGTAGGTCATACAGAAGCCTACAAGTCCCATGTGCGCCGTAGAGCGCGGATGCAGCGCCGAC
CCATTGGACCACGTCGACATGGGCGTgggagcagcgacgaagacgaggacgtatctgaaggagctgctcgtggcgtGGGTAGTCTACAACTCGGTAACAC
CAGCACCCCGGAGCCTAGAATGCGCGCCAGCGTGTTCACTCGTTGGTCAGTTGAAGAGAAGCTCGCGTTCTCTGCATACATCAACGATCAGTTCGGTGAG
ACCCGCGTGGCTACTTGCAAGAAGGTAGGGCTCACGGAGGCTGCGGTGGATAGGTCCAATATGACTGAGCTGATCGTCGCTGCGCAGAACTTGCTACTAG
ACTACGGTGGCCTCCGTATGGTAGGCGACGAGTGCTGCCAGCGCCTCAAAATCTTCCTGTTCTTCGGCTGAAGGCAGTCTCAATCCAGCTAGGTTAGGTG
GTGAGTGGAACAAATCGCTGCATATATAATTCACTGCGGCAGTCTGCACGTCATTGAGATTGCAGATGTGGAGACCATGGCGATTTACGAATTATGTTTT
CGCTATGGGCGATTTACGAAATGGCgtgaatttgtattggtgcagtttcgtaGAAATCCGTGaactgacccgatttggcaaatttagacggaattcacaa
taaACCTGTACTAAATGTTAAGTCCCGAGGCCTCAAGCGGTATCATGTATAACAAATTTCTGGTCCTGGTACTCGAATCTTTTGGTAGTTTTGTGTGCCC
GAAGATGGTCGATGCTGTTTCGTGGTGTGCTATTGTGGATTTCGTCTAATCGAAGTTTCTGCACAGGGTTCGTTGAATCAAAACCGCTGAACGAATCGtc
caaatcggctaaatcacttcagtTGACTATGAGtactttataagtacgacATCGGACTTAACCTCTTACTTCCCTGCCAAAATGAGGGGCATATTTGACC
CTTATGTTGGAGGTACAACATAAGAATATATAGGAATTTGTATAGGATGTTTGCATAGCTATGTTATCGGGATAGTACAGGGTTAGTTCGTGATACAAAA
ATGACAGATCCAACATAACGGGTCATATGTTGGTTAACATTTGTTCTTCGTGCCTCTTATGACGGTAAAGACGACATAAGGACTGTACTGTTTATCTAGT
TAGTCCTATTTCTGAAATGTTGCACACGGTCGGCATGATGACTTGACATGTTTTGTCCAGTAAAAAGTAAGCAACAAGACGTTTCAATTGATTGCATCCT
GCGCTACGCGACAGAAGTAAAGTAAAGACTGTGCAGCCTACGCTTCATCGTCCGCCattccttcatcttcatcttcgctgcCATTCGCCTCGTCCCCCct
tccttcatcatcatctccCTCTGCCATTTGCCATGCCTTCGGCCGGAGCTgttcgacgccgacgctTCTTCCCCGGGTGCGCAGACGGTGGGCGGTCACG
CACTTtgtgctcctgcagcaggttccGTGGGATGTCATTCCCATTGCTCCAGTCGTCGTGCCAAATATGGTAGCAGGTTTTCTCCTTCCCCTCGTGCACT
ACATTGCAAAGGTATTTGCTGCTCAAAGCATAGATGTTAGAATGAtgtttagcagcagcacgaagcagaaaCACAATGTAACGTACCGTCGATTGCTAGT
CGAGCACTCGGGACAGAAGTACTTGGTGAATTTCCTCGGCTTTACCTAGTAGAGCGCACAGACTTTGCAGGAGCGTTGGCGCCGCTTGAGGCCCTGGACG
TTGTCGACAGTGTCTGGGTTCTCTTCCAGGCGATGGCCATTGTCCATGACTGGCGTCTCCGTAGTTGATGCTTCCTGCGCTGATGctcttcgtggtggtg
atgcCGCCGTCCTGTCCTGGGCACGTGTTGCGCTCTATTCAAACGACATTGACAACATAAGAAGACGTAATGTTGGACCAGGACCCATCACAGAAATCTT
ATGTTGCCTCAGCCAACATAAGGCGTACCTCAATAGCTGTGTAGGCCTCTGGAG