Description :
From Genome Similarity Track
Location :
contig_65:111858- 112968
Transcript NameFunction/comments
g11224.t1hypothetical protein

Sequence
1110 bases(100 bases per row)
GGCTGACTCTGTTGTGGCCACGTACTCGAGGCCGGGGGCGGTCAGGGTGTATGATTTGCAGGCGGAACAGCTGAGCTTCCAGGTGCAGGTGGGGGGTCAG
GTTGCAGTGAGTTCTGCGGTCTGGAACTGGGACGGCAGCGCGATACTGGTGGCCACGCAGGACCAAGCGGTGAGGCTCTTGGACCCGAGAGTGAGCGAGC
AAGTGTCGGCGCCGGGCATTGACGCTGCACATTCGGGCAAGAGACACTCGAGTGTGGCCTGGTGTGGACGCACGAACCACTTTGCGACGTGCGGAAGCAA
CCGAATGCAGGAACGGGAGTTGAAGTTGTGGGACCCGCGACAAATGTCCAAGTGCGTGCATCGAGAAGGCTGGATGCGGGAGGAGTGGGCCAGTTGTTCC
CGTTGTACGATGCGGACTTGGACTTGTTGTACGTGCTGGGCAAGGGGGATCGCAGTGCCAGGTTGTTTGAGGTGGACTTGGCGCGGGCTCCGTATGTGCA
CGCGTTGGATCACAGTGCACTTGGCAGCATGACGCTTGCTGCGGTGTTGCTGCCAAAGGCGGTGTGTGATACGAATGTGTGTGAAGTTGCGCGGGTTCTG
AATCTGAGTGCGACCGGAAGCAGTGTGGGCGGTAGCTGTGAAGTCTTGAGCTACCGTGTGCCTCGCAAAGAGGCGACGCATACGTTCCAGAGCGACTTGT
ATCCAGCCACATTGGCGCTAGATGCGGCGATAACGTCCGAGGAATGGCGACAGGGGCGCAATGCCGAGCCAAAGGTGCAGACTGTGACTCCGACGGTCAA
AGGTGCCGTGGATATGAGCGGGAGTGTGTTTGGCCTGCACGCGACGAACGCGTCTGCGGCGTCTCCCTGGGGTGCAGCGGTCTCTGAAGGCGGTGCCGCC
ACAAATGGATGGCAGACTTCAGGATGGGAGCAAGCACTTTCGTCAACTGCATCATCGAGTGCACCGTCAAAAGCTGCGTCTGACGTCAAGACAGGGTGGG
GATCAACACGAGAAAGTGGAATGAGCCGGAACCCAAGACCCAACCTGCTTGTGCTGCTGTCGCAACTAATTCTACAACTGCAACCACACCTCCTCTGGAC
CCACCGAGCG