Description :
From Genome Similarity Track
Location :
contig_65:111855- 112965
Transcript NameFunction/comments
g11750.t1hypothetical protein

Sequence
1110 bases(100 bases per row)
GCATCCGTCGGCTGACTCTGTTGTGGCCACGTACTCGAGGCCGGGGGCGGTCAGGGTGTATGATTTGCAGGCGGAACAGCTGAGCTTCCAGGTGCAGGTG
GGGGGTCAGGTTGCAGTGAGTTCTGCGGTCTGGAACTGGGACGGCAGCGCGATACTGGTGGCCACGCAGGACCAAGCGGTGAGGCTCTTGGACCCGAGAG
TGAGCGAGCAAGTGTCGGCGCCGGGCATTGACGCTGCACATTCGGGCAAGAGACACTCGAGTGTGGCCTGGTGTGGACGCACGAACCACTTTGCGACGTG
CGGAAGCAACCGAATGCAGGAACGGGAGTTGAAGTTGTGGGACCCGCGACAAATGTCCAAGTGCGTGCATCGAGAAGGCTGGATGCGGGAGGAGTGGGCC
AGTTGTTCCCGTTGTACGATGCGGACTTGGACTTGTTGTACGTGCTGGGCAAGGGGGATCGCAGTGCCAGGTTGTTTGAGGTGGACTTGGCGCGGGCTCC
GTATGTGCACGCGTTGGATCACAGTGCACTTGGCAGCATGACGCTTGCTGCGGTGTTGCTGCCAAAGGCGGTGTGTGATACAAATGTGTGTGAAGTTGCG
CGGGTTCTGAATCTGAGTGCGACCGGAAGCAGTGTGGGCGGTAGCTGTGAAGTCTTGAGCTACCGTGTGCCACGCAAGGAGGCGACGCATACGTTCCAGA
GCGACTTGTATCCAGCCACATTGGCGCTAGATGCGGCGATAACGTCCGAGGAATGGCGACAGGGGCGCAATGCCGAGCCAAAGGTGCAGACTGTGACTCC
GACGGTCAAAGGTGCCGTGGATATGAGCGGGAGTGTGTTTGGCCTGCACGCGACGAACGCGTCTGCGGCGTCTCCCTGGGGTGCAGCGGTCTCTGAAGGC
GGTGCCGCCACAAATGGATGGCAGACTTCAGGATGGGAGCAAGCACTTTCGTCAACTGCATCATCGAGTGCACCGTCAAAAGCTGCGTCTGACGTCAAGA
CAGGGTGGGGATCAACACGAGAAAGTGGAATGAGCCGGAACCCAAGACCCAACCTGCTTGTGCTGCTGTCGCAACTAATTCTACAACTGCAACCACACCT
CCTCTGGACC