Description :
From Genome Similarity Track
Location :
Scaffold_61:111854- 113551
Transcript NameFunction/comments
Physo_138193hypothetical protein

Sequence
1697 bases(100 bases per row)
TTGGCTCCCTTCGAGCTAAGACAGAGATCCGATTCGGTGTCACCCAGCACACACCCCGCCGCGAACATCTGCGCCAGCATGTCAACAACAAGCGCGACGT
TCGCATCAAGAAGGAAATTGCAAACGCTCTGCGAATACGGCATTACTAAAGTTGAGAAATGGTTCGAAACGGGGTGGCTGAATCTGACAGGGCAGCTTAA
CGATTGCAGGTTGGCCACCAGCCTCACGTGCAAGTTCCTGCCAGGAGTGGTACCATCCGAACGACGTGGTCAGACCTGCAAGCGAACGCTTGTCATGGCG
AGAGCAACTCGCTCAAAGCCAAGCCGTTAGCTCAAAGCTAGCGGAGCGGAGCAGGATGGGGCCCGAACGCAGCGCAAGTTACTCGGCCCCGCCGCAATCG
ACAAACCGACTCTCGTTTAGCTAAGCGGAGCGGTATCGGTGCAACTTCAAATGCTATTGATCAGCCCCGACCGGGCCAAGAAGACCCACGGCCTGATGAC
GGCGGTCGCAGGGAGAAGTATCTTGGCCAGAGCAAATTGGTTGAGGCTCGACCGGTCATGGCATCATATGCAGTGAGGCAAAGCAGATCGATCGGTGCCC
CACGTGCAGGAACAACTCGATCGTGACCGTATCATAAACTTCTTAGGCGTTCCGCTCGAGCGCAAACGCAAAGCGTCCTCCGCGTGCGACAACGAAAGCG
ACACTTTGCGTCCTCCTTTCCTCTTTCCTTTCGGTTGGGCCCCGCTGCGCTGTCGGTGGGGCCTTCCAACACAACGCACGACGTCCTTCAGCGCCAAAGC
AGCCCGTTACCGTTCGCCCAGCTGGCGGCGACAAGCGCCATGCTGTGCATCGAGTCTCTGCACCAGCAAGTCCTGTCCAAAAGAGCGGGCGCTTGCATAC
AGTACAAACATGCTGAGTGGCGACTGCCCTAAACGCGACACGAGACCTCCCCACGGTGGATTCTGCACACCGTGCGCTCACTCCTCAATCGGCAGGCGTC
GACGCACAGGCAGAGCCCTCGCTGTCGTTTATCCCGACAGGGATCCGTTAAGTAACACGTAGTAATATGAAGGTGCTGGCGCCCACGCACATGGCGGCGC
GCGTGGCGGTGGCCGCCCTGCCGCTGCTGGCGACCGCGACGGACCCGGACGCGACCAACTCGAGCTCGGGCTCGACCATCATCTACATCGTCATCGCCGT
GATCGTCGTGCTCTTCGGCATCGTGGCCTTCTTCGTGTATAAGCGCAACCAGAACCGCCGCAAGCGCAGCGACGGCCACGGGGGCTACGGCCTCCCGTCG
ACCACGGCCCGCACGGCTATCAGCCGCGGCACGTCACACGGCGGCAACACGGTGTTCGAGCGGCGCATGGACTCCACAGGGTACAGCAGCCACCACAGCA
AGGACAAGAAGGCCTCGCACAACCACCAGCACCAACAGCAACGGGTAGAGCGCCCTCCCCAGTGGCCGGCCAACGGGGCCCCCACCTACACCCGGCAGCA
GCAGCAGTCGCAGCACGAGTACCAGCCGCGCTACGACTCGCAGTACGAGAGTAGCAACGGCCTGCAGCAGTCGTTCCCGCCGCCGCCCCCGCCCGAGGTG
CCGATGCTGGAGCCGCACGAGGACCACCACCACCAAGGCCCCGGCCTCTCCATGTTGGAGCTGCAGCAGAGCCAGGTGGCCATGCCTACCAGCAGCG