Description :
From Genome Similarity Track
Location :
contig_6:111846- 116536
Transcript NameFunction/comments
g1777.t1hypothetical protein

Sequence
4690 bases(100 bases per row)
GCGGTGGAGCTAGCGACATCATGTCGTAGCGGTCGTCCACCATGCTGTGCAGTAGCACGTATCGCTCCCGTCCGACACCGCGTGAGTTGTTGTTGGCCTC
GGGCGTGAGAGAAAGCACCTCTTCCATTGTGTACTTGAGCTGCTTCCGATACCGTGGGTTGTTGGCGCAAACGAGTCGATCGCAGCGCGTCCCTCTTCCA
TCAATGCCGACGACATCTCCCGCACCAGCGCAAACGGCAGGTCCACCGAGAGCACCTTCATGGCCTCGTCCCCGCGAGACGAAAAGCTGGACGAGATCCA
CTTGGACACGCGACGCGTGACCTTCTGTGTGTCGAGCTGGTAGTTCCGGTAGTTCCTATCCCTCGACTGGTACTTGGCATCGACCACCCGACGTCGAAGA
TGGGCTGCAACGAGCTGCTACCTGACGACGAATTGCCGCCGCCACCACCGCTGTTGTTGCTGTTCATACCATCGCCAAATGGTTATTGCCACGGCCACCA
CTAGCAGCAGCGTCGCCATGCGAGGTCTTGCCAGACGTTGTCAGCAGCTCGCTGATGTACTCGGGCAGCGACGTCACATTCGTCACCACATCCGCTTCCG
AGTGGCTTTTCACAGCTCGAATCTTCACTGCTGCTTCTCTTTCATCATGTGCTTCTGTACGATTACCATCCACTGCACATTCTGCTGCGCGCAGTAGTCT
TCGAGGTCCTCCAGGTGCAGCGGCTCTGGATGCAGGTAATCTGCGCCGATGCCCTGTCCCACAGCAGCATCGCGATCTGCATCCGGAACAGCATCGTGTC
CGACGCCTTGCCAGCGAGCAAATCAAGACCTTGCGGCCGCCCGTCAGCACCTCCGACGCTGGTGGTTTGGATTCCAACAGCGCTGAGCTCATGGATTCAG
CGACCAGCGACACGATCTTATCGATAGCGAAGCGCACGCCCATTGCAGCGACCGACGAGGCTTTTGCGTATGCTGTTGTGAGCTTGAAGCGCGACACCAG
CGCATCGTAGCGTCCACCCTCCGCGATGATGATCTGGTTGTCGGTCGTCGCGACCAGCAATGAGGCTGATGTATCACCAGTGGTGCCGCCATACGCGGCC
TCCCCGAGCAAAATTGCCTGGAAGATAAAGCCTGACGTGTACCGCTCGGGACGCGGACTCAGCCCCAAGTCTAAGCGTGTGCACACGGGGCCCGACAACT
GAAGGAACTGCATGCCCTGCAACAACAAGCGCAGAGAAGTAATGCCCTCGTTGACATCCTTGACAATACGTCGCAACTGCGCATCGCGCTTCTGAATTTG
CTTGCGGCCCACTGAAGATGCCGAACTTGGATCACTGTCAGACAATGAATCTCGGTTTGCAAGCGCCCGATTCTTTGCAAACAGCTTCTGCACCTCCAAC
TCAATCATGTCGAGCGACGTCAAGCAGTCCTCTGGTAACAGGAAAAAGGGTTTCAGCGCTTCGATGGCGCCTGCCGGTGCTCCATAGTGCTTCATCCGCT
TCGCGACAAATTTCCAACGACCTGGCTTCAGGCTTGGAGTCTGAGTGGACGGTGGGCCAGCGTGCACGTAGAAAGAAACCTCGTTCGAGAGCAGTCGTAG
CACCTCGCGACGAGCGCTAGTGGGAACGCGACAGAGGTCAAGGATGCCACGCGTCACTCGGGCGTCATTGAATCGCATGTAATAGGATCCTAGACAGCTC
GGCAGCGCTTTGATCACGCCTGACACGACTTCCAAGCCTTCTAGCTCCAAGAAACGGAAAGACCCTCCATCATCCCAAATGATGTCGAAGTCAGACTCGG
TGAATTCGCGCGGGTGACCACCCCGACGCCTTTCCGGTAAACGCGGTCGAATTGGAAGCATTTCAGTCGCGATACGTTGTGTCGAGCCACGAAGCGAGCA
AGTCTCTCGGTCAGATCAAATGGAAGCGATACGGACACACCATTGCCATCCAGCATCAACGATGCGTTGGGCGCAGCGTTAAGAGTGATGCCGTTAAAGC
TCTCTGACAGACGTGGCATGAGTAGCGGCGTTGACATTTCAACGGCTCCATGACGCTCGAACACTTTCTGTAAGCACACCGATATTTGGTTCAGAATTAA
AATACAGTTGTCTACCAACTCAGCAAAGCACTAAAAGGATAACTGCTTACCTGTAGCACGTTCCGGACGTACGTTTTCGTGCGCAATTGGGTCTCGTAGA
TGCGCATTTTGACCGACTCCAGGTGATCGTAGGTGTAGTCGACGTGATTAACTGGTTCCTGTGATACCAGCGCGTCAATGAGCTGCCCGAAAAACTTACC
TTGCGGGTTTGCGAGAGTTTCCAGTGCCTCGCGAAGGTAGGATCCTTCCACCTCTATCTTCGCGGGCAACAATGGGCTTGCCAGCAGTTCCTTCGCATTT
GGCCGCTTAGAAGGATCACGCTCGCAAAGCCACAGTATGATCTTTTTTACATCTTCAGACTCGCTGAAAGCCGCCGGTAGCTCATGCCTTTCCCTCAAAC
CAGTGAGCGCCTGCGCACGCTCCATCAGCGTGGTGAATGGTGGTGACCACATTTCGAAAAACAGGATTCCGAGCGAGAACAAGTCTGCTTTCTGGTTGTA
CCGTTGGCCCTCTCTTTCTTGTTCAGGTGCTCGGTAGAACGCCGTGCCGACTCCAGCGGTAATACTGCCATCGACCACATCGGCCGACATCGTAGTCATC
AGATTACTGTCGTGCTGTACACTCGATCGACCGACGACTCGTGTACTCTCCAAGTTCTCCAGCTTCAGCCGCCCGTAGAGCTCGGCAGCAGATGACCCGG
TTGACTCGGATAATATCGCGCCAGTCACAGTTTCGTTTGGTGGAGAGGAATCCTCGTTGCTGCCGTCATCGTCCATAGCTTTAGGAGGCCGAACTGCGAG
GCCAAAATCTCCCAGCTTCACAGTTCCTTCAGAGTCCAGGAAAACGTTGGGCGGCTTGATGTCACGGTGAATAATACCTTGCCGATGAATGTACACGAGG
GCCTCCAGGATCTGTCGGAACATCGTCCAGATCTTATCGGGGTCTTTCCACAGTGCTCCTTTATCAATCACCTCTCTGAGAGCATTGCCCTCGCAGTACT
CCATCTGAATGTACAGTTTCTCAAACTTGCGCTTTCTCTCAGGAGTAGGAGTTCTATGGGGAAGCGCCTTGCGATGGTAGTCGCTACCTTCATCGTCGCT
GGAGTCGTCCACATCTTCCATTGGAGCTTCTTCCAAAGCTTCCCAGTCGAAGCCATCATCTGGATAGCTCTCCGACTCAAAGCGATGCGAAGAGAGTTGG
AATGAATGGCTATTACTTCGTAGGCTGCGGCTTTCATGGCGAGACGTCGGCCATAGCCCTGTGCTGCTGCCCATTGTGCCTAACCAGTCGTCTTCGTCCT
CGTCTGTGGACGTCATGGCCCCCAATCCGTCTTCAACGCCAGACGAAAGGCTTGCGTCACCATACAAGTCTTCCTTCTCGCTTACGATGGCGCCACTCAT
GATACCCTCTTCGTCGCTTAAATCGCTGTCCTCAAGACTCGAGTCCTCTTCGTCGTCGCTAGACATTCCACTTTCACCTTCAATCCACGCCTGGAAATAC
CGCACAATGTGGCGGTGCTGCATTCGGGAAATCGTCTTCACCTCGCGCAAGATCTTCTTCTTCATGGCTTTATCGTCCGGGTCCAGCTTCACTTTCTTCA
CCGCGTAAAGCTGTCTGTCCAGGCGGTTCCGCACCTTCACCACTTCGCCTCCTCCTCCGCGTCCCAGCAGCCCCAGCTCCTTAAAATCGCCGTGATATCT
CGAGTGATATCGTTCCGCAGCTGCAGCCGCATCCAAATCGGACGTATCCGAGTCCGAGTCGGACAGACTCGACGAGCTGCCGTCGCGCCTTGAGCTCGCC
TCCGTCTGCTGCTCGTAGATGCTCGACAGACTCTCTCCATCGCTGCCACTGTACTCTCCGTCAATACTCGACCGATGTCTCCGCCTTCTCCGCCGTGTCT
TCTTGATCGTCTCTCGTTTCTTCCTCTCGGCGTCGATCAGCGCGATAATCTCCTCGTTCTTCGCGCGCGCCTGCGCCTCCTGCTCTTGCAGCAGCGCGTC
CCTCCTGCTTTTCCCTCGTCTCTCGGTCCTGCTGCCGGGTCATCATCTGGTCGAAGAACGACGACTGGTCCTTCAGGTGTTCCTGGATGAAGTCGGTGGC
GAACACCACGAGGTCGTACACGACGGCGTCCCCGACCTTCTCCAGGGCGAGCGCCTCCATCCGCGCTGCAGCTTCTGCGTCTCTGTGTCCGACAGCCCGT
GCTTGGGCTCCACCGTGATGTTGGGTGGCTGCTGGAGCGGGTACGCGCGCGCCAAGTCGAAGTGCAGCAGCACTTCGGCCGTCGTGGCCGAGCCCGGCGT
GGCTTCGCACGCCAACCGGATGGCGAAGATATACGTATAGAGCGGCGTGGCACTCTGACTCACGAGGTCCCGGTCGAATATGGCCTGCAGCACCTCCAGT
TCCTGGGCCTGCAGCTCGCGCGCCTCGGCGAGCGTAGCGGCATCATACGTAGCGGGTGCATCTTGGACGCACGCGTCTGCAGAGCGGAAAACGGAGCATC
CCAGGTGGACATTTAGCTTGTTAGCTGCAAGAGACGTAGGTGCACACACCTACCTCTCTTCTTCCCCTTCTTGCGGCCCATGGACCGGTA