Description :
From Genome Similarity Track
Location :
scaffold_8:111830- 156739
Transcript NameFunction/comments
g536.t1 myosin-like protein
g537.t1hypothetical protein
g538.t1hypothetical protein
g539.t1 hypothetical protein PHYSODRAFT_554387
g540.t1 pyruvate dehydrogenase E1 alpha subunit

Sequence
44909 bases(100 bases per row)
CTGCCACTGCGCGTCTTCATGAAGCTCTTGGCGCGTTGCGAAAGCTCGTTCAGACGCTTCACGCTGCCACGGCGACCCGAGTGAGCCACCTTGAATGACT
CCATCCGGTCCGCGATCGATCTTCCGCGTCCTGCACGAACCGAAGCGGGGTCATCACCGAAGCCCTCGTCAGCATCCGAGTCATCAAGGTCGTCCATCTC
GTCCACCCACTGGCCGCCACCATTGTACTCCTCCTCTGAATTGTACTCTGGCTCAACCGGCACAGCCTTATACCTCCTCCAGCCACGCTGAATCTTGATA
ATTGCACGACGCTGGAAGTGATACTCTTTGTAGTCCAGCGACATACGAGCGTACGACTGCAAGACAATGACAGCACCGATCTTGTTGCGCAGGCGACGGC
GCTCCAAGAAACCCAGCACGATACGCTGGATGGTGCGCGCCTCGTAGTACATGAAGTCGGACTTCATGGCTTCCAGCTCCTCCATGACGCCGTTCTTGAA
GTAGATCAGCGTCTTACCCATCTGGTACTCCAGAGGCGACTTGCGGCCGATCGACGTCATGAAAACGCTGCACGTACGGCGGACATCCTTGCTGTGCATG
GACGGCGGGAACATGATGGCATAACGCGTGGCTAGCTCCTTCGGGGTCAGACGACTCGGGTAGCCAGAACGCGTGATACGAATGGCTTCGATCACACCGG
CCGATCGCAACTGCTCCACGATCATGCGCTTGTTAAACTCTGTCGGACTCTTGTTCGAGTTCGGTTTGATGCAGCGCACATAGTGCGTGTTGGTAGTTCT
GATGTTGTCCATCAACTGCGCCAATGACGTCTTGAACTGAGAGCCGAGGCTCTTCGGAGCCTTCTTGCCACGGCCGCTGCCACCCTCTGCCGTAGCCTCG
ATGTCAACGAAAAGTTCCGGAAGCAGTGACAGACTGCTGAGCTGAATCAAGTCCAGTAGATCCTTCTGCAGCGTGTCGCGATGTTTCTCCATGAAACCCA
CCGTCTCGTACGTGACAGGACCAGCGTAGTGGTTCACGATGAACTGCGTACGCTTGACCTTGGGGAAATCGATGCTTTCGTTTACCACACCGTTCTTCTT
CGTCTGGTGGTTCGTGCGGATCTTGTTCACCAGAGCCTCCTCGGTGTCGCGCGGCTGACGCAGGTGGTCGTTCATCAAGGCGATGATACCCATCTTACCT
TCAATCACCTCCACGATACCCTGGTTGTCCTGGTACTGAATGTGATCCCACTGCAGACCTTCGCGGATGTACTCGTCCTCGACAGTCTTGAACACATCGG
TAGTGAACTTCTGCTGCAGCTTCTCGTTCGCGTAGTTGATGCAGAACTGCTCAAAACCGTTGTGGACGAAGTCCTCAAAACCGAAGATATCCAGCACACC
AATTTGGCCCTTGATACGGCTCTCGTCCGTACTGATAGCCTCGTTGATTCTCACCACCATCCAGTCAAACATCTTGGAGTAAATAGTCTTTGCTAACGCA
TCACGGTTCTCTGCCGCTTCAATAGGAGCAAGTGGCACCGTCACGCTGTCGTTACGAGTGATCACCGTACGGTTGCACAGAGCTTCCTCGATTCTCGTCG
TGGGCAAACCGAACATCTTTGCGACCTGTGACAGAGCCGAGCCGCTCGAAATGCGGGATCCGTTTTCGCCACTCTTGTCAAACATGACCTCACCAAGCAA
GAGAACACCAGCCAGAATCTTGAAGAGCGTCTTTTGCGCGCTGCTATCCAGACCAATGATGGACAGCGACTTCTGCGTGCTAGCAAACCACTTGGCGTCA
TCTAGTCCAGGGATCTGCATCTCCGCAAGGGAACCAGCATACTGATACTGGCAGTCAGGGTCAAGACCAAACTCCTTCCGCTCACGACTGGGTAGACCAG
CCAGAAGCTGATAGAAAATGTGGTAGTTGCGTTCGCCTTCAGCGATCGACACCACACGCGATTTCTCTAGCAAGTATGTCTCGCACTTGGCACCAATCAG
TTTTCCGCGGCCGTCGAACTGCAGCTGCGTGAACTTACCGAAGCGCGAACTGTTGTCGTTACGTGTCGTCTTGGCATTACCGAAAGACTCGAGAAGCGGG
TTCACATCAATGACCTTAGCGATCGTCTTGTCCTTGCGGCCACCAGCCACACTGGCCAAGTGATTCATCACAATTTTGGTCGTTTCCGTTTTACCAGCAC
CAGACTCGCCACTCACGAGAATACTTTGGTTCATCTCGTTAGTCTTCATGTGCTTGTAGGCAGCCGTTGATGTCGAGTAGACGTGAGGAGGCAACGAATC
GCGCGGCTTCTTCAGGTACTTCTCGTGTAGGTGGTCACCATACAGGTTCTCGATCCATTTGTACGGATTCACTGCAATCACGATGTCATTCGTGTACGTG
TACGGCTTTGAGGCAGTGAAACGCTGCTTTAAGTTGAACAGAATGGAAGGTTCGTTCAAGTATCGAAGCAGACGCATGTCCTCCACGCCCTCAGGGTTGT
CGTGAAGGATTGCAACAGGCAGTGATTCCACCTCGGTAGCCGTTGGTCCAGCAACAGCACGAATAACTTCCGGGTTCTTGAGATCGACAACACGCTGTTC
CGAGTCACCTGAATCCAGAAAAGCCGTAATCGTAACCTCTTTTCGGCGGTCATTGTAGTCCACAATCTCGGAGAGCAGCCACACTTCCTCCTTGTCAGGA
ATGTAGCACTGCACTCCCGGCACAATCAGGTTCTGCTTGTTGCTTGCACCTGCAGCTTGCTGTCGGAGCTGCTCCTCCTTAATTTCCAGTTGCTCGTTCA
TGAAAGCCTTGCGCTTCTTTTCCAAGCTGAAATTGCTGCGACGGCGCTTAGGAGGCACCCAGTACGTCTGACGCTTGCGGATGTAGTTACCGCGGCCAGT
TGAACGCTCAATCATGTGGCGCGGCTTGAACGGCATCGGTGCAGCGGGTGCTGCATTGAACGCTGGCTTCGGAGCTGATCGACCACCGGCCGGGGAGTTT
TTCGACGGGTTAAACGAACCGAAGGTCGGTTTTGGTGGAGCAGCGGAAGGCGTCGTCGCGATCGATGGAATCGAGTTCGTCGTAGCTAGGAAAGCAGCCA
ACTTGCTCTGGGAGCGAGGCTTCGTCGATGATGCAGGGGATGCGGACGGCTGGTGCTTCATGAAGTTATTCAGCTTGTTACCCCCTCCTGTGTTAACCTT
CGGCTTTGACGGAGCGGGGGCAGGCACGTCTGGCTTGGGGCTGCTGTTGCCCTGAGCGAACACTGCCTTGCGCTGTGCGAACTGGTCGCTTGACGTACCA
CGACCTCGGACAGGTGCAGACTTGGGCGGGGAAGGCGGCTTAGAATCCGCAGTGGGAGAGGCCGACGACTTGAAAGCAGAGAGGTTCGAGCCACCAGACC
CTTGGTAAGGGCCTGAACCATGTGTCGTCTCGACAGCCGGCGGGTTGGATTTCATGAAAGCCGCGAACTTATTGCGAGCATCCCCGCCGGTCGGCATCGA
CTTAGGAGGCTGTTTGGGCGACGGAGGTCTTCTGACTGTAGGCTGTGGCTTGGGCGCTGCTTTGGGTGCCGGTGGTTTCCTCACCGAGTTGGTCTTCTTT
GGCGGACCAGATGGGCGCTCAACATGCGTCAACGGAGATCCGTGGGAAGCCGGCACCTGGTTCAGGAAGGCGTTCAGCCGATTTGCATTGGCACCCCCAC
TGTTGCTCCTCGTGTCCTTCTGTGAGGGCGGCTCCAACGGTGTCGAGGGCGGAGAGCCCGACGGCGACAACATTCCACCTTCCACCTGCGGAGACACTGG
CGGGGGAGTAGATGGCGGCGTTCCCTGCGGGGATTTGTCCACCACCTTCTTGTTCGACTTTTTCTTCCTCGATAAAAACCCACCCTTCATGAAACTTGTG
AGCTTGTTGTTGCTGTGCGCCTTCTTGACGGGGGACGGTCCTTGTGAGCTGCCGGTGGACGCCATCGACTCTGCATCTGACACGGGGTCCTCCTCGTACT
CACCAGTGTAGCCAATCGTGCCAAACCTGTCGAAAAGGATGGAGAGCGTCTCCAAAACGGTAGTAAAGTCGGCCCCTGCGTCCAGTAGGTCGTCAGGCTG
GAAGATTTCACCCTCGTTCAGCCCCTGCTTCTTGCACCACTCGAGAAACAGGCGAATATTGGCCTTGGAGTGGAAAACTGTGTTGAGCTTGTTCACCTTG
AGATTGGCCGTCGGATCCACGCCGTTCGCCAGGAGACAGAGCAACTGGCCATCGCGTAGCATGACCGACAGGTGCTCGCCATGATCGTTGGATGAGGCCG
TGACGCTGCAGATCCACTCCTGTAGCTCCTCCGTGCGACGCACCGTCATGCTGGAGAAGGATGCAGAGAGACCAACACTCCCGGTCGCGTCCGTACGAGC
TGATAGATGTTCCTGTGTCTAGCTACAAGTCCGAATAGACTGGATAAGACGAAGAGGAAGGGGGCGAAGGCCTCGACACCTGACACTGGACGATGTGATG
TCCCTGTTGCCTCTCGTAGTAGCGCGCGAGTTTGCGATAGAGCGGCTTCCGGGCAAAGCTCGAACTCCCTCTCGGCACGCGACGGAACACACAGGAGATT
TTCCGCACTGCTTTCTCCAACGCCGCTGCACACGACCAGACACGCTGATACTGGACCGTTGACAAAAAGCTAACTGACTCCAACGGCTGCCAATCGAAGT
GATGGTCAAGTGACAATTTGCACGCCAAAAAAGACTTGAAAAGACTATGGGCTCCCTAACCCAGGCGTCTCTACTGTGCCTCCCATACGAAAACCAACAT
GTCGAGAGCAAGCAGCTGGTGGGAAAGACGCCTGAGACCGACGATAAGGCGACAAGGTGCAGTTTTGCCTTGCCTTTGTTTGCGGGGTGTTTGCTTGCCA
ACATGGCACATTTTGCGTCGCTAAATACGCACATTTGTGCCTGGATCCGGCTTCACAAGGATGAAGCTGTTTAGTTTGAAGTGAACGTGTCGAGTGGGTG
CATCATGTCGTTCGCGGAAGCCGCTGCATGGGAAGTGAGGGCTCTACAACCGCTTGATCAAGTGTTTAAATTTAAACACACATGTCATGTCGGTATCCGT
TACTACATGTTCTCGCGCTTGTGAGGGTCGTCCAAGTCTATGGACTTCAGAGCCTTCACATGCCGCTGGCAGTGGAAAACTCTGGGCTGTAAACAGGAAC
TCGAACAGGAACTCGACTTGCAACTGGATACAACCGTCACTCACCACCACAAAAACACCAGCGATAACCCCCAAGCCACCCCGAGCGAACCCAAGTCCAG
TCGCTAGTTGCTGTACCGAAATCCAACTGCCTTGAGAATATCCGCTGGCGCTGACGATCTGCACCCCCAGCCAGCAATCGCCACACATTCTTGACTTCTT
GGTGAAGTGACGCTGGCAAGTGTAATGCATTGCATAACGACAAGTGCTCTTCTCAGAAGAGTCTTCTGACACCGAGACACACGAATACAGACAAAAACGC
ACTTGTGGCGGAGCAAACTCATCGAGAAAAGAAAGAAAAATGCACCAAAAATTGCCACACTTCCATCAAATGCAGCCACATATTCATCAGCCAATCATTT
GCCTTCTTGAAGTTGTTGCCCTAGAAGATCGCAACGTTCCCAACCACGACCACGATGCAATTCCTGCTAATAAGCTTACTGTTGAGCTTGGTGGCCCTGC
TGTCCGTGGTGCAAGCTAGCATCTACACAGGCTACACTGTGGGCCGGCAGTTCCAGTACATCGGCAAGTTCTGCTTCACTTGGACGCCTACGCTGGACGA
AATCGCGGGGGTTCGTACAACTGAAACCTGAAGGAATATTAATAATGACAATGCTCACACTAACCATTTGGCTGTATCCGCCAGCGCATCACAGGTGAAA
TCGAGACGGATGTAGACGGACTTCAGGTGGCCATCTATGATGACGAGGCGCTCTTCTGGAACTACGTCATGACAGACAGCTCCTGCGACTGCAACTGTAA
AGTCTCGGCTCAACACACCAAAGGTGTCTTCAACGTTACTGCAATCAACAGCCACCACGTGACCCCGTTTACCTTCAACGTAGATATTCACCAGCACCTA
CGACCGAGGTTCTGGTACGTGGCGCTCGCGCGTTGCGTCCCAGGAGGAGACCAGTACAAACCTTCATTTGCGGAGATCACGGAAACCAATTTCCGCAAAT
ACTACTTCTCATCATGGTTCAATATCCACATGACCCAGGCGGATGGGAGCGAACTCCCTGTCCAGCAGCAAGGAATGCCGACGATATATGCCGTCATGAC
GGCAGTGGCGGGAGCTGCAGCGGCGGCACAACTTGTGGCAGTACGGGGCATGACAAGGAGCGAGTCGTTCCACCCAATCATGCGGATCCTTACGCTGGTT
GTGGTGTTTTTCTTCCTGTGCAACGCCCTGCTCTGCATCCACTTCACAATGTACCAGTCTAATGGTGTGGGAGTGCCGTTTTTCAAGTACGCAGCCAATA
TCACCGAAGTTTTCGTCTGTGTGGGCACACTACTACTTGCCATGGTGATCGCGAAAGGATGGACGATCAACAGCGTCGCGCTGGACGGCCAGATCCAGCT
TTCGTGCGTCATACTGGCCATTCTCGTGCTTTACTTATCGATGGCGATGTGGTATCTAGTGTGGCTTGATCCGGCCTCGACACTTTACATCTACGACTCG
TGGCCAGGTCTGGGTATCTGCCTACTACAGATGTGCGTACTCGGGTGGTTCATCAACACAATCTTGGAGACGCGTTCGTATGAGAAAGCCTTGATGAAAC
GGCACTTCTTCCTACGAGTAAGTGCTCGACCTGATGCAAGTTGCCGAATGGATTTTTTGAAAATGCTCACTCGTTGGTTCCAGATGTGTTGCCTGTTCTC
GGTGTTTTTCGTAGCGCTGCCTGTCATCGTGCTCATCGCATCCTTCTTGTCGCCATGGGTGCGAGAGAAGACGGTGGCTGCTATAACGACCTCATTGCAT
TGCTTTATCTATTTGATACTCATCTACATGCTTTGGCCAACGCGGGCACCACGGGACTTCGAGGTACGTTGCAGTGGCGAGAGACACAAAGCCGTGATTA
ACAAATTATGTTGAATTGTACATGCAGCGTCTGTACTCGGTGTCATCACCGTCTGAGAAAGCATCGCTGCGTGATCAGCATCTCCCCACTGAAGAACTCT
GAGCCACTCAGCAAGATAGATTGCCTGCAAGTAGTTTCAAACGGTCCGTACGAAGGCGTAGATAGTGACATTTTCGTTTTAGCCCACTTCTACATGATGG
TCCTGTTGAGTTGCACTCTTGTCTTCCAGTAAAGTGTAAGTGTTTGAGTCTCTAGGTGGGCCAACTGCGATAGCGCATGCAGCACTTCATCTGTACAAGC
GTCCGAGTCGGGGTTCTCAATTCTTTTAGTCGTCAGCTTCACCTCCTGTGAATCAAAGCGATGCACATAATTTACAGACGGTTCCAGTGTAACACAACCC
AGAGATTATTCTACAAACCTCCAGAAGTTTTTCGAGAGCGGCAATGGGCTCTAATACTTCGTCCATATCCAGCGCTAGCTCTTCAGAGCGTTCTCCATCG
TTGTTGATTTCTGGAGGATCCAGACCGCTCCAGTTGTTAATCGCGTCCAACACAAGCGCTCGCATCTGTACGGGGTTATCGTCAGTGTTAAAACGTTCAG
GAATATTTCAGTCCCCAAGTTGCGTACCGCTGACAGATCTGCCACATCGGAACACTGGATAGTGAGATCAACGGATCGCTGCTGATCTTCTGATGGAGTG
AAGCGCAGCAGAATGAGGCTCCCTGAAAAGGCCCGTAGTACAGTCCATAACCTCCCATTCTGCGTACGACAACTACGACGAAGTCGCGGGATCTCGTCAG
CGGGAATTTCCAGGATCTGGCACAGAAACAACACCATCTTCTCGACACGAACTTTTTCGTTGTCTTCTTCTTCGTCATCGTCGTATTCATCTTCTGCATT
GAAGAAGGAGGGTATGGACAGTATGAATCGCGATGGGGGAGATAATGCCAGAGGTGCTGCATTTGGCGGCACAATTCTGGCCCACAAAGCTGCAAAAGAT
GGGTTCTTTTGTGCATGGTCAGCTAGTGCTGCCCACCATTGCCCGCCAGCCCAGAGTGAAGGTGTTTCATTCCCTTCAGAGTTCGCTCTGCTGATTGACA
TGACCGGATCGTGATTTTGACGAAATGCAGCGTGAACAGCAACTTGACTCACTGGCGTCTCTTCTTCTATCGGCTGGCTCAGTTGTGCAAGTAAAAACCT
TCGGTCTTGAAGCAACGGGATCGTCAATGACAGTGGATCTTCAGGAGGTGTCGGCTTCAGCTCCGACGCAACATGCTTTGCTTCACCGTAGTTGTCTTCT
TGATATCCCTTCGCCGACGGACAAAATACCATCGAGCACGATACCCATAACACACCTTGGTCTTGCAGACTAAGTGTGTCTGGGTCAAGGATGACGATCT
GTTCTTTTCGTGTTGCTACATCCTCCAGCCGAAACGAATACGTCGTAACTGTTTGTTGGCGAGTGCGTACGTACAGACACAGCAACCTACACCCCACCAT
GACAAGCAAAACCATAGAGAGCCGTTAGGATTCGTAAGGAACGTTCGTACGAGGAGCACGTAATCGAATGGCAACTACCAACGTACCAGTCATCGAGTGA
GATGATAGCTTCCGGGTTCACAAAACGTAAGGAACACAGCAACTTGACGGTCTGTCGATCCGAGAAGGGTCCAGCTATTGTCATTGAAGCTTTCAATTCG
CACTTGACCACGGACCCCACACCTGAACAAATCAAAGAACTGATGAGACGGCCACACACTAGCAGCAACTGATCTCCTACACAAACCTGAAGTTTCTACT
TGTCGAAGTATTTCCAAAGCAGAGTGTAAATTCTTGAGATGATAATCCATTTCCTTCGATTGGGTCCGTAGGGCACTTGACTTAGCGGAAACCTGTGCGA
TACGCTGCAAAAGGTTGCGAACTCGAGTCTCTTGCATTGGTTTTTCAATGGGCAGATCCTCTGCTCGGCTTCGTTCCGGCCCAGATATTGGCAAAATACT
AACCACCATCGTGCGAAGTGCAGATTCGTCAATAGTTGTGATTCGTCCCGAGGTAAATAGGAACGACATCAAGCGGGATCCGTCATGGGTTGCCAAACGA
ACGATCCCCTGACATTTTAGAGAAATTAGCACATTATTGGGTCTGGTCTTGAAGAATGATGCCACGTACCGGTTGAAGAGGTAGCTTCTCCGCAGAAATA
CTTGAGTCATTGCTGAAGGAAACATTTGCATCTGCATCAGCGAATTGGGCTTTTGCCCGTAGGTCTGTGACCCGACACACGAACGCCATCCCACTCGAGC
AGAAAATGAATGCTGCCAAGCTGTTTACGAACACCAACGACTGTACTGCACGTCCAAGCTCCATCTTTAATGACACGGGAAGAGGCTCCGTCGAGCAACC
ATTCTTCAAACCGACAACCATGGCCCTGCCTCGAGTACCAACTATAAGCAGCGCATCAAATATTTGCCGTGCTGCTGCCGCATTATCTGTCTCTGAGGAT
TCGACAGTCGCGAACGGAACGATCATTTGAACTGGTTCTCCCAGCCGAAGGAGTGTCCCACTGCGGATCACTGAAGCCTTCGCGATATCCCCCTTCGGTG
CCGGATAATGCACCAACGAAAACCGCACACAGCCATCCAGATCTCCCTGTAAAATAGCTGCTACACCGGCGTATTTCTCATCCGGAAACAAGCCCTTGAC
CAGCCTACTCTGATTCTCCACCTGACTACTGAGACAAAATACACACGTAGACTGTTCGCCTTCGATCTCATCAAGTTCCTGCGACTGGTGCCGCTGCAAT
TTTGAGCTTGGATTGGCGCGGATACTCACGATCAAAGTGGTTGGTGTCACCAAACTCCTCATCAGCGTGAGCGTCGTCAGCCCCGACTCTGCTGCCGTGT
AATGCACCGACTGCACGCCAGGAAGCTGGCAGAACCACTGCACCGAGCCATCAGTATCCTCGCTGGGTGGGCGTTCCAGCAGCAACTCACGTGTCACCAC
TCCTGCTCCAGGCTGCAAATGGCCGGGCAACGTGACGACCCACACGTTCCCATCTGCAGTGGAGACCAGGAGTTGCGAACCAGTTTCAGTGGGGTTATTA
CTGTGTTCTGCTACGTCGGTAATTGGCATGACCTTGGATCTAATCACACACTGATAAGAGAAGAGAAAGGATAAAATTGGTCCGATGAGTATGAAGTCAT
GGAATCCGAGCTAGCGTCCCAACTCACCTGTAAGCGACTGTTAACCAGGTAATGCAGCAGCGTTGGCCGGACTTTAACGACGATATGCTGACGCACATCG
TGGTTAGTGGACGCAAGAGGCAGAAGAACCGGAGAGCGGTCAGCAACACGAGCTAACTGCGTCGAAGAGCTTGAGACCATTCTCTCTTTTTATAAATATA
AATTAAAAGCTATTTAATCACGTATTGCCACAATTAAAAAGGGGGCACAGTACCGGTAAGGTACCAGCGCGTTCTAATTTAGAACTTCTAAACTAGATTC
CAGATATTTGCAATCGTAATGGAGCGCCTTCCAGACGGTCTCTTAGCGCACCTCTTCTCGCTGCTCACGGCGCGAGACGTGCTGCAGGTGACGTCCACCT
GCCGCTCACTGGCTGCGACCACCCCGTGCGTTCAACATGCGCTCGAGCGCGTCATCACCAGGCGTTTTGGCGCCGTCACGAGCTTCCTTCCAGCCTCATC
CGACCATTGGCCACGCTCGCTCGCCGTGCTTCACGGCGCCGAGATGCTGCACCTGAAGGAGCTTCTGTCCCACTGCGACGCACGCTCCTTCGAGGACGCG
GCGCTGTGCGCTCCCTCGTGCGTCGTCGTGAGTCGCGCGTGGCTCGGCGGCTACCGGAAGCGCTGCCAGTCCCTGGAGCAGTTGTTGCTGCAGTTCCGCC
GGTCGAAGAGGCAGCAGAGACGACAGCAATCCGTCAAACGGAAGGACAGTAGTCATTTAGAGACACTACGGATTGCACCAAGCTCTTCGTTGACAGAAGC
TGGAGCTATGATCGTCTGCGGCCATGGAGCTCTGCTACCTGCCGCTCAATGTGTGGGTCGCCGTCGACGCGCAATCATCAGTGGGGACGTGTTCAGGGAG
ATCGCAGTGTACGCACCAGAGCTGAGAGGCTTCAGTTTAAGCTCGTGCATCGACTGTACCTCTTGTGTGCTGGAACAGGAGGCCAGAGAACTGGAGGCGG
AGGAGAAGAAGAGGGCCAGGCATGACGGGGAGATCGCAGGCTCGGAGCAGCTGCTGGAACTGTTACAGAGGAAAAATGGGTTCCCTAAAGGTTTATTCTC
ACCAACGGAGTCCCACAACAGCAGACAACAGCAACTGGCCCCGCATTTGTCGGTGAACGGAAGGAGCAAGTACGCCACGTACTTCTTGGTGCCCAAGAAG
TGGCTCAACAAGTGGAGGAAGTTTGTTCGTAGTCAGGGAGATGACGCTCCTGGACCAGTTCTCAATGCAGAGCTCGTCTGCTTGTCGCATCAGAGAACGA
TCGTGCCGCCGTATATCTCGATGTTCCTCTCCGGGTTCTCCCTCGAGCAGTCACTCAAAGCTACCCAAGCGTAAGTTGTAGTTGGTTCTAGTAGTTTATG
GTTGATACTCATGTTGTTGATGTTTATTGGTGCAGGCTTGGCTCCACACCTGCTCGTCAATACGAGATCGTAACGTATAGCGAGTGGGAAGCCCTGTACG
ACCGGTATTGTGCTGAATTCGCAGTGGGCTTCGATGTAATTAACGGAGCATACCACTGGAGAACACAGGAGTGCCAAATCTGCAATTACGGTATGGGGGG
AGGCCCATCGTCTAACCAGCCGAACTCAAGGCGCTAGGACGCGTCACTGCTTCGATAAAAGAAACTCAAGGGGCTTTGCAATGACTTGGGAAGAAGTGGA
TTCCAGGACGGCATCAATATACTAACTATGCACATATATTCACAGGTTTTTACCGCAGGTAGACTCTGTTAGCTGGTCTCTAAGCCGCTGCCACCGTTCG
CTTTCTTTTCCCTCGATGCATCGACTTGTTTACCCTTCGTAGATGACGTAGATCAGTCGAGGAACGCCAGGTCTAAAGTACTACGCAGAATGCCCTTTTA
GGCAGAGCTCTTTCCTTTTCTTCTTTCTCCCGTAGTTTTGCTTGGTGGAAAGCTCCTAGCATAGCTCGAGCGCTGAAATGGGTGAAACTCAGCTGCCCGC
CATAGCGCCGCATGTGTGCCTCGTAGACAGCGTAGTTTAACGCCTGAAACCATCGCTTGCGAATCTCAAACTGGAGTCTTTCCTTGAGTGTTTCCTTGCG
CTGTGCGACGGCCTCGGTGTAAGCTCGTCTTGACTCTGCGAGGCCTTCACTTAATATCAAAGTAAACCCGAATACCGTGACCGCGATGCAAGATCCGACG
AGTAGATAGCTCAGCAGCTGCACGTTAATGAGTGACTCGGCATTGAGGTCATTTAGTCGGATCATAACACCGAGCCACAAAGTGAAATACAGTTGCAGCT
GGGTGATACTAGCAATGAGATTATCCGAGTAGCCATCATAGGGTTGAAAGTAGAGCAGAAACCACACCGTCACCAAACTTTAAAAAACTGGTTAGAACAC
AACCGCGATGCAAACAAATAAATAAAAACTTACCAAACACCGAGAGCAAGCAGAACTTGCTCCACACTTCCCTTCTCAACGAATACGATCACACCACTAA
GAAAAAGTTTTCGTGAGAGATCCACGACTTCAAACCACCAGTAGTCGTCCGTATCTGTAGGAAAAATAAAAAATATTAGGTTATGAGCAGCCAGAATTTG
AGTTTTGGGTTGTTCCTACATTCAGCGTAGATGAAACCCAGTCGAGCTTGAACCGTAGAGTCCTGTATAAGAACGAAAACGGTTAAAGTAAGGCAACATA
TTCTTCAACGTTCACAAACGGGTGACATACCCTCAAATTCTTCCGCTTCATGTATTTCGCCAGCTCTTCGTTCTGCACTTCTTTGCTGTGCATACGAACA
TACCGTCCATCCGCAATATGTTGCTTCTTCACCTCATCGATCCATTTCCGCCGTTGTGTAAGCATGCAATCATTATCCTTTAGCAAGGCGATACGGGCAG
CAACTCCACGGTCCTGAGCTATCCAAATTAGAAGCCCGAAGAATAACGGAATTCCCACCACCCACACGATGACTCCAATCGTAGCCACCACCCCAAATAT
CGCCCACTGTCCGTTGTAGCACACCAATCGACGATCGACCACGAGGTAAAATACGTCGCCAACCTCCTGGCAATTGTAGATCGTCAGTATCGTCTTGGAT
ACTGACGGATACAAAAATAACGCCATCCAGCAGTAGAGTTTCAAGCATTTGTTGCGATACGTGAGGAAATTCATTCGTAGCTTCACCCGAGCTTGCCACA
CGCGAAGATTACTGCGAATTATGCGTTTAAGCGTTTCACCAGAGAGCACATGCCGCGTAACAGGACATTTCGTATGTTCGGAGCGGAACAAGCCCAGGTA
CGGAGTGCGAACTTGAGACATTCCGAGCTCGCGCTTCAGCTTTCGAATCTTCTCATTGATCGAACGGGGCGACGAACTTTCGTTTTCCAAAACACCCTTC
GCCCCTGGCGTCGGACTGGCCGATGCGCTGTGTTTATAAAAGTTGTGCGTTCTCCACCAACCGCGTAGTATCCGAAAGGGATTGAAGCTTTCATCGTCAT
TTTGAATGGCCTCACTTTCAAGCACTGGAAGTCCACATCGAAGACAGTTGCGCGGAATTAATTGTAGCTTTGCGCGATAGCTGCGCATGCCGGCGTAGAA
GTACGCCGTGATTACCGAGAGAGCAATGACGACAAGGCTCACGGTGACCCTGCAACAAAAAAAAAGCGTAGAGAAAGTCATTAGAGATAAATATTATGAA
CATCAAGCTCAAGCAAAATAAAAAAAAAACTCACGTAAAATCGAAGTAAAACGTTTTTGTGACCACACAATCAATTCCAGCGATAGCGACCAGGTCCTAG
ACACCGGCACAGAGAGGTTTGTTAGTTCAACTCACTGATCACACAAAAGGTTTTTACAAGATTCTGTACCAGATTGAATTTTTGCGAGAAATTCATCAGG
TTTTGGACGTTCGATGACCATTTCACCACGAAGGAGTTCTGAAAATTACCAAAAATTTGGAAGAAACCAATGAAGATCTTGAACTTGCTCGGCTTTATCG
GGAACGTTCGGGTTGGAGGGCCCACATCCACGCCAAAAAGGAGCTTCTGGTTGTTTCGAGCTTGGAATTTTTTGTACAGCTCTCTGATTTTGTTCTTGAC
TCGATCCACCGTCCCTTTCTTCTCCATAAATTTTCTTCGGTTCTTCAGACTCATCCGTAAACCGGTACGTTCAGTCTTAGCGTTGACAGGTTTCATCCGT
CTATCCGCTTCGGCTTTAGTCAGAAGACTGATTTCCGTGAGGTCACGTAGATAAACTCTTACGCCGAAAATCCCACAGATTACTGCAATAAGTAGAAGCA
CAGGAATAACGAAATTCTGCCACCGAATCGAGGCTCGGACTTGTGCGTTCACTTCCCCACAGGCTATAATCACGATAAAAGACAATATCAGACAAATAAT
TATCAGAAGAGCAATGTCAGAGGATATTCCTTACATAAGCACGAATTGTCCCTCGCTCGCTTGTATCCGTCGGCACACACTGAACATATCGTTTGGTCGT
AGCCACTGGCACACGAGGCATTATTCACTGTTGCTGCAAGTGCTATCGTCTGCAATGAAATATCAGCATGACACGCCCCCTTCACCTAACGAAGAGCGAC
AAAAGCAAGTGAGGAACTGCCCTAGCATCAATAAAACATACGCCGACTCACATCGCAAGTGTAGAATGATTTCCCCGACAGACAGGAGAACAGGCGGTCA
GCAGGCCAGTACACATCGAAATCAATGAGCATGGAGCAGGAGTGGATAATATCCGACAGGTTCGCTGTGGGGTTTTCCAGGGCCGCCTTCTTGCATGGAT
CTTCATCTTTCCACTGCGAGGGATGCTTACAAGCGGATTCCTGTTTGGATGCTGGGGCAAAGAACAAATAATATCCTTCCTCTGTGCGCGGTGATGCCGT
ACCGATCTCCTCTGCGAGTGTCTGTGTAGCTCGACGCACACTTTGGTTACACTTGGCACCGGAGGGACACTTAAAACACTTATTTCCATCCAAACTGCAG
TATACACGGGTAAGTAATTAGTACACGTTCTATCTATCCTGGTTTAGGTCCGCACCTATACATGTTTTTGGAGCAGCGTTCGCAATACCTAAGTATCGTA
AAAAGGTTAGTGTTAGTGAAATCTTCGAAGTAGTACATGTACAAGTATGACTCAGACTTCCTTACCCCTGGTTAACCGAGAATCCCGGTAGACACGGCAG
TAACTTTACACTTTGGGCAAAACCCCGCGGCTCTGAGTCAGGTAGCGTACATGACACGTTTGCAGTGTAAATCCCTTCTTCTGGAGTCCTGTTAGCGGCA
GTGAAAACGGCGTCGCGGAACGTGACGACTCCCGTTGCAGCACGAATTACAGTCAACGGCGAGAACATTAACGTCTCGGTTTGCTCGCTACATATAGCGT
TTGTCATGAAACACTCCGTTTGATTGTCCAAAACTTCAACTTGGCCGTAGAGATCAACAGCTTTCAGGCGAGGCCAAATATTTTTCGTCGACTCGAGAGT
AAAATTCCGTGCCGGGATAGCAACAATGGATTCTTCGTCGGGTGGTTCGAGGATTTTCACGCCACTGGTGATGTTTTCAGGCCACCACATCACGTGGACG
TCTCTCGTGTTGGTCGCGATATCGTACACCTCGTTAGCCGCCATGGAACACGAGGTACACGGGTTTATAGACGTGAGATTGTCATCCGTCGATATCCAGA
AGATGCACCCGCCACTTGGAGCCGTGTTGCCTTTGCACATAATCCCCGACGTGGTAGTATTCGCAATCGACTCATAGTACAACGCCCCACCACGAGTGTA
CGCCGCATTGGTGATAAACTTGGAGGTGTAGATCCTGACAGTCGCCATTTCATCTGAATGGAGAGCCCCTCCCAACCTCGCGCTGTTGTTGCTCAAGTCG
CCTCTTTTCAATGTGACAGTAGCTTCATCCGTCAAATAAAGAGCCCCACCGTTATCGTGTGCTTGGTTCTCTTGGAAGACTACGAGCGTGAGTTTTAGTA
CAGAGGCGCCAGTCGCAGCGATGGCTCCACCTGCACTCGCAACGTTACGTGTAAACCGAGTTTGTTGCGCTATCGTGGCCTTTGACTTGGCGTTCATCGC
GATCGCGCCGCCATTTTGATCTGCAGTATTTCCTGAGAAATTCGAGCCCATGATAGTCGCTGAACCGCTGCGATCGACGTTAATTGCACCTCCAACCACC
GCAGTGTTGTTGATAAGCGTACACTCGGTGAGCTTTAAAACGCCGTCAACGGAGGAAATCGCCCCTCCGCCTTCATTTTTTCCACTGGAAGTAACACCAC
CATTACCGATGAATGTGGATTTGTAGCTCACCAAAACCGCTTCTTGACCTACGAAGATACCTGTCAATCACAAGGGAATCTCGTTAGCGTACGCATTTCG
AATTAAAAAGTAGCTGTCAGTTCGTACCGCATCCTTCACCGTGAGCGATGTTACGTGCTATCATTGAATCGTTCAGCTGAACAGCGATTTTATTGCCTGT
GTCCATGTAAATTCCTCCTCCCGAGTCATCGGCAAAGTTTTCAGAGAGTAGCAGCTCCTGTGCATGGAATATTGAGGATGTGTCAAGGAAGATGCCGCCC
CCGGAAGTCTTGGAAACTGAAAACGTTCAAAACCCGTTAGCCAAGGAGACAACCACAGCGACATTTCGCACTAGAAAAGCTCGTATCTTACCACTAAGCC
GTACTGTGACGGATTCGAACTGGGCTAACGCACCGTTGGACAAGCACACGCTTCCTCCTCGCTCGTTGGCCGTGTTTGAGCTGAGTTCCGAGCCTCCACA
ATAGAAAAACGCATTGGCGTTAACATAAAAGCCTCCTCCTGCGTCGGCTGATCCGTTGCTTGCGAATGAAGAAAGCAGCTCGAAGTTAGTTCCTAGATCC
GAAAGATAGACGAGATCTCCTTTTTGCACGTCCACTCGATTTTGGGCTCGTCCTGCGACGTATTTGAGGCCGACAAGGTCCTCAAAAAGGTCTTGCCACG
TCTTCGTTAAGAATTTTTCCGCATCGCGAGTGATATTGGAGTTTGAAACACTCATGTTGGAGCCCTTAATTACAGCAATGGACCCTCCGACAAGACCGTC
ATTTGACAAAAACAACCACGTATCAGCGCTCACGCCAGATGCCGTAGTTACGTAGAGGCCACCACCCACCCCCCTCGCATTATTCCCAGCGTGGTTCTCC
ACCACCATCAACTGAAAACTCTCCAGGTATACTCCGTACACCGCAATTCCTCCGCCTGTTAGTTGTGCTGAATTGTTGTAAAATACACAACTCATAAGGT
AAACTTCAGCACCGGTTGCACACAAACCTCCTCCGCTATCCCTTGCGCCATTTCCGACTACAGCCACGTTGTGGAGAAAAGTTGTGTTTGCATCTTTAGC
TGCAATTCCTCCACCTTGTACAGCGTAATTATTGGTAATAAGGGAGTCTAAGATGGTCGTGTTGCCACGACCGGAAATGAATACGCCACCACCTTGTCCA
CTTATCAAATTGGCGCCAGAAATGACAACTCCCGAAAGAATACAGTTTAACGAGCAGGAGAAGCCGACATTTGCACCATTGCCGTCTAACGTTATTGGGT
CAATACCATTCGCGTCGATACGTGACCTTTTGGTTGCGACGTCATCCCACGATAACAAACTCACTGGTAGCGTTTCACTAGTCAATTGAACTCCTCCCGC
AGTTGGAGCCATGTTGTTGGAGATTTCCACGTTGGAGTGATATACTGTAGCCTGATTAATCATCCCCCCACCGCCAGATTTACCACCTCGATTTTTAGAA
ATCAACGAATTCCGAAGTACACAATTTGAGCCGGATCCGAAGTATACACCACCTCCTGAAACTGTAGCAGTCGAAAGTGAGATATCTGCGTTCAGTATGA
CACAAGCGACAGCATTCAGTACGGCTAAGCCACCTCCAGAAGGTGCAGTACTTTTCGTAACGACGATATCGCTGACGAGAGCTCCTTCCCCATCAACGAA
CACGCTTCCTCCGTATTCAACCGCATCGTTTTGAGTGAGAATCGCTGCATTCTGGTTTATCCCGGTGCTCTCCTGGCTGGGGGATTGATACACTTCCGAT
GAATCTACGTACATCCCTCCACCACGCAAGGCCTTGCAGAGCTTAATAGCTACTGCAAAGTGTTTTAGAGTAGCGTTCGAGACTGAAATACCTCCACCGA
CGCCAGAAGGAGCGACACACAGTTGGATCGTGGTGGCCTTCAGCGATAGTACTCCTGAAGCGACTGCTAGTCCACCTCCACTCTGTGTGGCGTTATTCAA
TTCGATAATAGCTCCTTCCAACTTTGTCGTACCAGATGTAGCAACTCCACCTCCAATATCACCACTATTCTCACGTAATGTAGTGGTACCGGATAAACTC
GAGTCGATCGCGTACACTCCTCCCCCTACTCCCGCGTTATTGGATTTTATTGCTACACTTCCCAATGAAATTGTAGAGGATTCAGCATATAACCCCCCTC
CTTGTCTGGCTGCCGTATTCGTGAAAATGTTTACAGACTCTATCGTCGCAGTTTGCGCATTCTGTGTGAATACTCCAGCTCCAAGGGGTGCCAAGCACCT
TTCCACGTCAAAATACTGTAAGAAGCTTTGAGTTCCAGCGATAAATACCCCCCCCGCTGCACTTGTAGCTTTACAATTTTCGATCTTCGATGGTGCATCA
TTAGCCCCAACCACCGAGCTCGAGTTGACGTACATCCCGGCTCCACGTGTAGCTGTAGAGTGTTTGATCATCGCGTGGAGCAACGATACTTTGCTCTCAG
CACCAGCATACAAGCCACCTCCTACAGGCGCATCACATAGGTCCAATTTTGCGTCACTTAAAATTGCTGTGCAGCGAGAAAAGGAAACGCATCCTCCCGA
TGTCGTAGCTGATGAAGAGTGTACAATAAGATTTGTTACAGTCGGGCGTGTCCAATCCGCAGCGTAGAACCCACCACCTGAAGCTGATTGTTAGGCAAAA
CACACAAACAATTTCGTCAGATATATACTTCGAAGTAAAATACAAGATCAAGTTTTCTTTTCCACGTACCCGCTGTGCAATTGGAAACGTCTGATGCGAC
GTTATTCTCAAAAGAGCCATTTGACCCCATGAAAACGCCTCCACCATAACGAACGGCAGAGTTCGTACGGATCGGCGAGTTTTTAAGCACCAAGCTTGCC
GTATTAAGAAGTGCAATACCTCCTCCATCGTTTAGTCCGTGATTCTCGAGAATATTCACGAACTCAAAAGTTGAGCTTCCACTGGTAATCGATATACCAG
CTCCTACCGCCGCAGTGTTGTGTGAAATGGTCAGGGTGTTACCGGTAAATGCCCCCGCCACGCAGAGTCCGCCACCGTTCACAGTAGCGGAGTTATCTCG
GATCTTGCTTTCACCATCTCCGTTCATAGTTACGACGTTTTGGGTATATACCCCGCCTCCCTCACGTGCTGAAGATAACTTGATGACTGTATGGTCTAAC
ATCAAGCTAGACCCATCCAGAAAAACAGCGCCTCCTTTCATCATCGCAAAGTTGTTCGAGAGTTCGGTATTAATCAGCTTCAGTTGCGTTTGAATCGCAT
AAATCGCTCCTCCGTTTTGATCCGAGTTGGCGTTACGGATGGTGCTGCTTTCCAATGTGAATAGTGAGTTTGACACACGAATTCCAGCTCCATTCGTAGA
TGCTACAGCATTTTGTATCGTTAATCCAACCACTCGAACTGGGCCGCTCGAAATGATCAACCCCCCACGAACCCGTTCGCAATCTATCGTCGTCACAATT
TGGCCTCGCAATCCTCGAATAATTATCGAACTAACCGAGACAAATAGACCACAATTATCAGCCCCAGTGTAGGTGCCAGGATAGAGTAAAATCGTCTGAT
GGGATGCCACAAGCTCTAAAGCCCGTCGAAGTGATTTCACAGCTTTGGGATCTGTTCCAGTGGGGGACGTATTCATACGCTCTCCTGTTCCCTGGGTATC
GTCTCCATTTCCACTTACCACAATCACGTCACTCTGAGACTGCAGACAAACTGGATCACATGATGTTTGGGTACACGTTGACAGGTCTTCGGGGCAGATA
ACGGCATTGGTGCAGCTCTCCCCTACGTAGCCACTGAAACACGAGCAATAACCCTTTCGACATGCACCATTCAATGAACAATACCCGTTGGACGAGAGGG
GACAGGGAGCGTACACCGATTCCACCGCATCGTTTGGATCGACAGCTTCGTAATGCAGCGCCATCCCTTCGTACCTGACACTCTTATCCGAATTGAATGA
AAGAGTCACCTTTTCGATCCCAGGTGCAGTGGTGACAACGAAACTTCCGTTACGATAACAACCTCCCTTCCAGAGATTCTTCGTCACACCATTCGCAGTC
ACGTCAATCGTTAAACTGTCGTGATCACATTCGAGCCAAAACATCGAGAACTACGTAGACCAAACACAAGGAAACGGTTAGTTTTCTCAATCGTACCTTA
GCAATCGTAGGCAAACTTACGCTTAGCAACAAGCCGGATTGAGTCGGGGGAACTATGGTCCACATCTCATGGTCCAAATTTTTGTAATCGTGCCAGTGGA
TATGTCCTCTATTCCCGACGCAATCAAAACCGGTTGTGGTCGGGGTAGTCGCGACAAAAGTTGTGGCTTCACTGAGAGAGCTGCGTATGCCCCCGGGGTG
CACTAGTTGAAGTTGGTAGGTGTATGTCTGACCTAGAACAATCTTATCTTCATACGTAATATCGAGTTCGTTATCCCAATAAAGAGCGCCATCTCGATAC
AGCAAATAGCTGAGTGCATCGTCGTCAGCTTCCCAAAAAACAATAGCCACTATTCGTGAATCTACAAAAAAGTAATAAGAACAAAATTGGATTAGAAGTG
TACACATCAACTTCTGAAAACATACTTACGACATCCAACTGCTGGGGGACGAGGTTGATTGGCATAGCGCGGGGTTGTGAAAAATACAATATTGCTTGGT
TGTCCAAGTTGAGCATTGCCAGTCACCGCTCGCTGCACAATAGCGCGAAAACAATACATTAATTTCGTCATTTGCTGAGTAAATACCACAATTCTTACCA
CAATTGCCGTGTAAGCCGTTTCGGGGGTCAAACCATTAATCGTGGAGTTCTTCACGACTAAGGGGACACTTGTGGTAAACGTAATACTGGTATTTGACGT
TTGTACGATGTCAACTTGGTAGGTTTGAACGTAGCCCCCGCCAAAATCGATGCATGGGGACCAGTGGATAGAGACGTAAACATTTTCCACCTCAGCCACG
TGAACGTCTTGTGGGGCTAGAGGGACGGTAGTATTTGTCGTCGTAAAGGTAGTGACAGCACTGGGGGGAGATATGCCGATGGTGTTGTTTGCGAAGAGCG
TTACCTGATAATCCGTAATCGATAATAAATTTCCAATAGTGCACGAAAGAATCATACCCTCACAGTATCCCACTTCGTTCCCCGAACGTGTCATACTGAG
TCGGTAAGCGGTCAGTGGCACTCCGCCTGTATCTACGGGATCGGACCACGACACTTCGATCGCTCCACCGGTTATAGCAACTGACTTAGGTGGCTCTGGG
GGGCCCGGAACCGTAGCCACAGAGGTCGAATTAGTTGTACCATTAGTGGTGTCACTTCCTCCGACGGTATTCAAAACTTGAACTGTAAACGAGTAAGTAG
TAGATGGGAGTAACCCTCCAGCTTGAAGATAGACCATCGATCCATCATCTGCGGCTAATCGTCTTGATTCCAAACGGCGAGAACCTCCAGGTAAAGTAGT
TGCGGGTGCCGCCACTGATTTACGCACAGCATCTTCTGGGAGTTTCACACCATTAGCGTACACATTCCACAAGAGTTTCTCGATTGTGATTCCTCCCGTA
TCTTGTGGTACTTGAATTGCCAGTGTGGCTGAACCTCCAGACGTTTTCTGGACAATTGGTGCACCGGGAAGCGACGGTAGAGTTGCGGTAGTAGTTTTAA
ATTGTCCCACCCCAGCATCCGATCCAACTCCCAAACTGTTAGCAGCGAACACTTTAAACTCGTAATTCTTGTATGCTAGGAGTCCTCCAAAGCTGATATT
TGTCAACGTGGTTTCCTGTACAAGCTCCCGTTCACCACCAATATCGACGGCCCTCACCTGATAGTAGGTAATTGGACTTCCACCATCATCGTCGGGGCTA
TTCCACGAGAACTTGACCAATCCCCCAGTGGCGTTTATAAAGCTTAAATTACTCGGTGGACCGGGTGGCGAGATGAGGGTGGTTCGAAGCGTGAAAGATG
ACGAATTTTGGATAGAACCCACCTCATTCATACAGGAGGCTATGAATTTATAGTCAGTGTCCTTCTCGAGCTTCGTTTGCCAATAGGATGTGCGGGTGTT
GTTATACACCAGCCCCCAAATGGGAGTCCCTCGACTTGGGCTCATATAAACCTGGTAGTACAGGGCTTGGTCACTTCCTCTGTCGATCGGAGGCTTTATG
TCGACGTGAATTCCACCGCCAGTGGCAGCTTTAGATCGTACCAACTGGATTTGCGTCGGTACAGATGCCACTCCAGTCGAAAAGAGAGACTGCAGTGGCA
GCTTCCCATCGCCTCCTGGACACGCCGATGCATCGTTCAACGGGATGTAGTAAAAGCTGTAAGTTGTTTCGGGGCTCAACCCGCCAATTTCCACAGTAAC
TTGAAGGTCCAATGGACTTTGTGCCTTATACTCGTATAGATACCCATCAACCTGTGCATGCATATCCGAGAAGTGTTAGATTGAGTTAGCACATTTGCTA
CTTCGAGTAACGGTAAATACTTACCGTTTTGTTATCGATAAAAAATGTATATCCCGTAATGGAGACTCCACCTGATAGTAATCATGAACAAATTAGTTCG
GAACAACCTATAGCAAACTCATGTTTACTCACCAGTATCGTTTGGCCAGGAAATGCGTATATGGAGCGCTCCGCCTGTGGCATAGTTTAGTGTGGATTCA
GGAGGCATTCCTGGCTTGGTAGGGGAATCAGTGTTGAAGGTCGCCATCGCACTGAAAGCGCCGCGAACAAATACGTCATAGGTATCCCAATTTTGGAGAT
TAGTGCTGACAATTGCTCCGCCGTCCGTACTCAAGGAAGGCGAGTAGTCGATCATGTCTTTGATTACAGCTGCAGACAGGTCGACTTCGAAAATGTATCT
CTGGGTTTGAAAGACAATAATTTAGTTAGCGAAACCTTGAGAGTAGAGAAATTAGCAAACACTTACGCCGAAGTCGAAATAGCCGCTCTTCACAAGGTCA
GCAGCCACACTTTTGTTTAATGCAACGAAAGAGTCGGAAACGGAAATGTTCCCCCAAGTGAGGGCGTTTGTATCGTTGTCTAGAAGCGACACTCCCACCA
TCTCGTAAGCAGTTTCGGCGGCCAACCGGAAAATCGTAATGTTTGTATCCTCTGCGTAGCTGTAAGCCTGCCGAAAACGCTTCCTGAGACCTTGTTCGCG
GTAGTAAATCATGTATGAGATGTTTTCGTGGCCACCTGTCCATATACGACATTTATATGTGGATAATTAAGATGCGTAATTAATTCAAGTATTGGTACGG
ATCGTACCTGTATCAAGTGGAGATCGAAGGAGTAGAGATATTGATCCTCCTGTTCGAGACGAATACGTAGAAGGCAGTCTGGGCGGTCCAGGCCTTGACA
AGGGCCCACTAACAAAGCTAAAAGACTCGGAGACATCCCCACCGCCAACAGAGTTGACAGCCTATACACATATAAACCTCAATAAGGCGAAGTGATGACA
GAGCCAATTCAATTCAAGACAAACAAACCTGCGCTTGTAAACGGTAAGCCGTATTTGGCTTGCTAACGCTCACAGGTATCAATGACGACGGTTGTCCCGT
CCCGTCGTATGCCAGCTTCACAAATACGACAGACTTGAATCAAAAGAATCCTCACCCACAGCATTAACACGTAACTTTACCTTAAAATCTCCGCTCTCCC
CGGCAAGATAAACTTTGTATCCAATAATAGGAGCCCCTCCCGTATCAATTGGGGAGGCCACATTTACGGTAAGTAATCCACCAGTCTGGTTTACCAAAGT
AATTTGTCTCGTTGAGCCTGGCGTGGTAATATTCATCGTAGCAAATGAGACGCTAGGAGAGTCAGTTCCACGCCCAACTGTGTTGATAGCCGCAATAGTG
AAAGTGTATGTGGTGAGCACCTTTAACCCGCCAAACGGGAATGTTGTAGTGTTATCCGATGTGGGTAATGTGCTTGTTGAGTTGCCAGCGCGAATAGAAA
TACTGTATCCACTGATCAACAGGCTCTGTCCGCCAACGTTAACTGGCGGGTTCCACTTTAGTCTCAGCATTCCCCCCGTAGCTTTATCCAGCGTTGGGGG
ACTCATTACCCCTGGTACGGATCGATCTCCATCGTCCTGTACCACAACTTTCAGCACACTGTTTATTCCCACCGTTGCTCCTCCAGAGAAAATCTGGAGA
GTGAGGTAGAAATACAGGTACGGGAAATCGTAGACGTCGTTGTCTTTAATCACAATACTTGCGGGCGAGGATGTTTGGCCATCGATAAAGTCCACAGTGG
TCGAAGGTAGGCGGAATCCTACTTCGAGCTGTGTTGTGCTCTCGAGACCAGTGAAAAGAATGATCCGAGCACTAACTGCCGAGCTTTTCCCTTTCAACCG
GTGAAGCTGTAGAGGCAGAATGCGCGCGTTTTCAGCGATAGCAACTTCACTTTCCACAAATCCGATCGTTCCAGCATCTCCATCATCGCGAATTTTAATA
ATCATAGATGTTGGGGGAAACGGGTCGCTACGGCCAGGGGTTGTATCCGTCAGAGTTAAGTTTATCGTCCGAGCGATGGGCTGGTACGTCTCATCGTTAA
TAATTGTCACTTCGAAACTTTGGACGGTTAGTTCACCAACAAACGTAAAAGATCGGGCTGATACGGGAGGCAGAGTGTAGTCTATACCCTCGGTGGCTGT
GCCAGTGCCGCTCGTATAAGTGCCTGTAATTGTGCTGGAAGATCCGTTCACACGAAGCAGTTGGATCGTCACGGAGCTCACATTCTCGTACACTGTTAAA
GCGTCCACGTTGAAAACAATAGCACCACGCTGTGTCACGTCTGTTTCAGCGAATATGTCGGCCGTCCATTCACTAACTCCAGCCGAGTTTCGAGAACGCA
CTCGGAACGAATAAACGTCTCCTGGAATGAGTTTGGGAACTTCAACTGTCGTTTTACTGGTCTCTGTTTGCCCACTTTGTGTCGTGTTGGTGTTGGTATA
AGCAATCTCATACACGACTTCATCTCCACCGGTATCGCTAGATGCATCCCACAGCAGGAATACCGAAAACGATGTCCGAAGTGAGACACCAACATTTGTA
GGAGTTGAAGGAAGCGTAGCTGGACATGTCAGTACTTTCAGCGTATCGCTACGAGCACCTTCCCCGACTGCCGCTTCAGAAGAGACAGCAGATACCGCGA
ACAAATAAGACGTAGCTGCATGCAAAGGACCGACTTGGACCAGCATCGAGCGAGTCGTGGGGTCTCCTAATTCTGCTTGGTTGTTTGAAGCTTCAACCAA
GTAGGAGCTTTTTTTCTCTCCATTCTGATAAAGATTGAACTTCGAAATTGGAGCTCCCCCGTCATCCACAGGGAAATACAACTTGAGCATGATCATCCAA
GCTTGCAGTTCAGTATTATCCGTAATCCATTCAGGGACTGGTGGCGCTGCAGGAGAGACAGCAGCACCATTTACCACAATTTGGGTCGTCGGTAAACTCT
CACCCATCGCATTTTTAGAAGTCACGCTCACTGTGTACGAACTCTTCGCTCTCACGCCGAATAGAGTGTAGGTCAATTGAGATGTGTTCGTAGTCGTACT
AAACCCACTGCTCGACGTATCCACTTTAACTGTAAGATGAAAAGACGTTAAATCGATCCCACCGGTATTTGAAGCAGCGACCCAAGTTGCAGTCAAATTT
CCTCCCCTCGCAACGACTTCTAGCCGAGTTGGAGGGCTTGAAACATCAGCAGTAGATGTAGACGATAGTAAGGTTTGACTCACAGCGCCTACTCCAATTG
AGTTGCTTGCTTGAACAACATACACGTACTGCGTTGATGCAACCAGTCCCTGGTCATCCAGGAACACCATCGTTGCCCCATCCGCTGGTATGTCCGCTCT
CCAAGACCCTTTACGCTGAAGTTTGTACCCTGAAATGATATCTCCACCACTGTCCAAGGGTACTTTCCACGTTAAGCTAATAAAGCCACCAGTCGATTTC
GTCATTGTAAACTCGCGCGGTTGACTTGGTGCAACAATACCTGATTTCGTAGTAGCAGACACCAGAGGGCTCTGTGTACTTGTCCCCATTTCATTCCAAG
CTGCCACTTTGTAGCCGTACGTCGTGTCCTTTATCAGAGATCCACGCGTATACGTAGTACTTGTGTCATTGTACAAGAGATCGCCTGTGCTTGAGTACAG
CGCATACGATAGGAGCAAACCACCTCCGGTATCTTCACTTGCCGCCCATTTAATAATTTGCATGCCCGAAGTACTTGAAACAACGGCCAAATTCGTCGGA
GTGTCCGGTATCGAGACTAAAGGGTCCGTGCTACCGTAAACAACTGTGCGAGTGAGCAGTGCTGAAGGATCCTCGCATACCGTTGCGTCATTGACGCCAG
AGACGGAAAATCCATACGTGGAATTGGCTACCAACCCCACGACTTTCGCAGTGACTGAGGTTGCTTGTGGACTAATTCCCGATACTCTTTGACGATACTG
AGCCTTGATTTCGTAGCCAAGGAAGAACGAGATGTCGTACGCCGTAACGTCAACGCCACCAAAGTCCGCAGGGGGAGTCCAAGAAAAGGTAACAGAACCC
CCGGTATGTGCAAGTGATACAAGGTTTTGAGCTTGCCCTGGTGGAGATAAATACTTCGTGGTCGCAGTGAATGCATCACTTAACTCGCTCGTGCCCTAAA
TACAAGCAGTAGTCAGATTGCTATGGGCATTACATGCAGTAAATAAATGAATTTAAAACTTACCACGCTGTTAGTCACCTTGTACTGCAGCTTGTAAGTT
GTAGAAAACGTTAATTTCGTTGCGAGAAATGATGAGGCGGGGCCTTGATAAACTTGGCTAAAGACATTCGGGTATTGGGCAGATGTCATCAGCAGCGTAT
AGTTCAAGATTGGAACGCCTCCGATATCCAAAGGAGGCGCAATATCAACAAGAAACACTCCACCTGTTTCACTTGATGATTTTAATAACGTGGGTTTTCC
CGGAATTGAAGCGGACGTCGTCGTAAAAGAGACCGCAGTGCTTGCTGCTCCTACGAGTTCAGCTTTACTGATAGCTTCGACGGTTGCACTGTAACTTGTC
AACGGATTGAGGTTGTTTGTCGATACGGTACTGCCACTTGAAGTGTAAGAGCTCACAAAAGCCCCAGCGCTACCAGAAACATTCGCGCGGTAACTTCCAA
TGAGGGAACCTCCTGAATCAAACGGAGCCGTCCACGACAAGGTTGCCATACCTCCAGTTACTGCCAGAACTTGTACATCCAGAGGTTTTGATGGAGGGGA
TGGAGCTCCCATTAAAACGGCCACAGGAGTAGCGTAGTTTCCCAATAAGTGCCCATTATTTGCCACAACAGAGATTGTATAACCTGCTCGAGCTTGTAGC
TGTGGAATGACAATGCTGACCATTTTAGTTGGTAGCTCTTGCGTCGAACCCGTCTGAACTTCCATCACACGCACAGTATATGACAACGACACACCTGCTT
TCGCGCCCAAATACCCCGGAGCCACCCATGAAAGGTTGACAGCTCCACCGGAAATGACAAGAGCTTCAATCGCCGTGACCAAACCCGGGGGCGATATGTC
TCCGTCATCTAGGATTTCAACTGTAGCGACCGCTTTCGAATCATCGATAGCAATCCGTCCACTGACGACTCGGAGCTTCAACTTGAATATCTTTTGGACT
TGATACGTTAAATCATTCACAATCGAAATACTGATTGATCCTTGCTTTTGCTGATCAGCAAACTCAATAGTCTTGGTCGAAATGACGTAATCTACATCTT
CGACGGCGCCGTTGGGCACACGAACCACATCAACTTCGACCACACTATTTCCACTGAACTTCACCGTCCTCACAAGATCCACAGAAAGCGCAGATACCGA
TTCCGAAACAGTATAGTATTTTTGTCCGAATGCAAGGAAACCTGCATCTCCATCGTCCGTAATCGTAACTTTCGTTTTAGCAAATTCTCCAATTTGACCA
GAATCACTGTTAAATTCCTGGATCGAAACAAAAAAGAATTTGTCTAGATCGACCGCCACCTCATTGTTAAGGATGGTAACTTGTATCGATTCAGAAGTCG
AACTCCGTTCGAAGTCGATTTCACCACTGCTTTGCACGTACTGGACTCCGGCAAGCGCAGATCCGTCACTTGTAGAATATAAACACTTAGCCGCTATGAA
TCCGCCTTGAGTGCGAAGCAGTGTAAGGGTTACTGAGGTTTCATTTTCGGAGACTTCTACCCCACTGCTAGCAAAATTAATAGTTCCAGGAGAAACAGGA
TTCGTCGTCACCGATAAGCTTGAAGACCACACACCACTGCCTGCCGCGTTCACTGCACTAACTTGAAAGATATAAACCGTTGCAGGAACAAGTCCGCTTT
GGGTCAGTGTCTCAGCATCACTTGAAGTCTGAGTAGTGTCGTCAGCTGTGGTCACGTTAATATCATACGAAATAGAGATTGCATCTCCCCCTGTATCCAA
TGGCATCACCCATACGAGAACAATAGAATCGTGCGTAACAGAAGCTGTCGAGAGGTTCTGCACCACACCAGGTACGGTAACCTTTTCAGTAGAAACAACG
ATCGGATCACTCTGAAGACTTTCCCCCTGGCGATTTATCGCTGATACAGTGACTGCGTAAAACGTGAGTGCCGTAAGGCCAACAAGATCATACTCGTTGT
TGGACAGCTTTTTCACCACACCAAGGGTTCCGTTCACGTAAAAGTTAAAGTCCGTGATGTCTTTCCCACCAAAGTTAGCAGGCGCGACAACTCCAAATGT
TAAGTGACCTCCGGCTACTTCCACTAGTCTTGGAACGCTGACTTTGTCGGGAGCTGTAGCATCGGACGTATTGGTTTTCAACGAATAACGTTCACTTTTT
CCAGCCGTGTTGACAGTCTGGATGATAATGGAGTACTCCGTTTCTGCATACAATCCAGTTACTTTGAACTTTGTCTCGGTGGTGTCGTAGGCGTCGATCG
TCGATGTTCCCCGAAGTATTGTCAACTCGAAGCGAAGGCGAGGGAGGCCGCCAGTATCTGGTGACGCTAAAAGACTCAGCACAATAAACCCACTACCTGG
TTCAGCCACAGCTGAAGGAGCGGCGGGAACAGATCCAGCAGCACTACGAGCCACGAGGGTGGCTGCTTCTGAGCCGGATACCACATCATTCGACGCAAAT
ACCGAATAGATGTAGCTTTTGTCAGCCAGAATGTTGTCTTGGTCTTGAAACTTTGTGGTTCCTTCAACAGCTAGCACATTGCCAACGAAGTTGTTATCAC
GGGTCACTTTATACTGCTTAACGTTTGCACCACCCGAGTCATCGGGAGGTTCCCAAGCAAGTAAAATCGTTCCACCGGAAGAAACCAAGATTTTACGCAA
TTGTTTCGGAGCTCCTGGGGCACTTGTACCGCTTGTAGTTACATACACAGATGCTGAATACAATCCACGACCTCGTGCATTTTCTCCAGCAACCGCAAAT
TCATAATGAAAAGAAGCCGTGAAGCCGTACAAAGTGAGTGACGTTGGGGCAGAAGCGCTGACATTCGCCATGACTTGCAGTAGGTTGCCTTCGGCGCCTC
CGTTGACTAAATACCAGAGTAAAGGTTCTCCTCCTGAAGAGCGCGGAGGGTCCCACGCTATAGTTACTGATCCACCAGTCACTTGAATCATGCGAACGTT
TTTCGGCTGCGACGGAACAGACGCGTCTTGTGTCGTGATGAGAAGTTCATCACTTGGTGTCACATCTTCATCCGGACGACATAGCGTTCGAAAATTGTAC
CCCGAGACACTGAACGCGTACTGCGTATTGGGTAGAATGTTCGGGATCAAGGCTGTTTGCACCAACGACTTCCGGTTTTCGTACACCACCTCAGTAAGTG
ACCAGGAGCCATTTGGGAATTGACGACGTGACTGCACCTTGTACCCGACAACACCAAGTCCTCCTGAGTCCAAAGGAGCGCTCCAATTTAGTGTTAATTC
CCCAGGATCCTGAAGCACAACCACCGGCGGGGAAATCGCGCCAACAGGTGTCGGGCCAGTGGTGAAGAAGGCTTTCTCATCACTTGGACTGCTCCATCCC
TAGTAGCAACAGTGATACATCGTTAATACACATTTCAAAAAGAGAAGGAAAGCTACTGAGCTCGGTACCTTCGCGTTCTCAACCGACACAATAATAAAGT
ACTCCGAATTCGAGAGCAGACCATAAATGGAGACGTTCGCGACAATTTGGTCGCCGTAAGTCGAACTCTGGACGCTGTCTTGTGCGTATTGGCGGTATTC
CAATGTTCCTCCAATGTGTCGAGCGATACTGAGAACATAGGAAGTCAACGGTAAACCCCCACAGTCAAGTGGGGCAAGCACGCTCACGTTTAATGCCCCA
CCAGTAGCGAATATCAATTCCGGCGGAGGAGGTTGCTGTGGTGCCACTGCTACGTCCCCAGTCAATACGTTGAGACTCACTTCTGGTCCTTCTAATCCAC
CGCTGTTCACCCCACGTATAAAAAATGTATGCCACTTGCCAAACTCTAAGTAACCTACAGGTAGAGACAGCGCTGATCCAGGCACTTTAATGGCTCGCTC
CACGTTATAACGTAGGTTCAAGACCCTGATACTGTACGTGGCAATCGCGATCCCGCCCTTATCGAGAGGGGGCAGCCATGATAGTTTCGCATACCCACTA
GTAACAGTATCGGCGAGGAGTTGAACGACTTCAGTCGGGGCCGAAAGATCTCCAGTTGAAATATTGAGAGTCCGAGTGCCGCCTAATCCGTAGCCATTGC
TAGCCCTAACAGCGGCCGTGTATGTCGTATTGAATTCGAGGTCACACATGGAGATACTATTCGCCTCGGTGGTACTTGATTTATAGAAGTTGGCGGCCGA
TTGCAGCACAGTGACAAAATAAACAATCGACACCAAATTTCCACCCAGAAACTTCGGTGGCTTTAAAACCAACGTGATACATCCACCTGTGCTTGATCCT
GCTGACAGTTGTGGCGGACCTGATAAACTCAAATCTCCTTTGTCTTGAATGACCACTGAAAGACTCCCACTAGCCGTTGCTCCATTAGTGGGGTTGGAGA
GCATAGCCGTATAGTGCCTGATTTCATACGCATCGCTATTCCGGATACCAATATCCCTCGTGGCTTTTCTAATTCCATCGTCGAAGGACACGACTTGGTT
CACCTGATATCCACTGATACTCGAACTGACGGTTGATGTCAACGTTACAGACACTACGCCACTGTCTCCTCCCGTACGCAACATAACAATCCTTACTACC
CCCTGACTCTCGGCCACATTTAACGCAGCTTTTTCAAAGCCCACGGTTCCTGCATCTCCATTATCATCAAAAATGACTTTGCATTGCGTATTGCTCAACG
CATTGCTCGTAGCAGACACAAGAACCAGCTTCAGCGACACAGCTTCAGCTTCGTACTTCGGGTCATCAAACGCTGAGATTGTGACAGTCTTCAAATACTC
CCCAGGCCCGAAAACGACGTGTCCTGTAAGACAAGAGAGGCATTTAGCTCTTCATATTCCTGCGCAACAATAAAAAGATGTTTACCTGTGTTGTGACCCT
CCGCATCAATAGAGCAAGTCGCTCCACTGGACGTCGATTCGCAACTCCATTTTGGAGCTATGGTTCCAGCACTTATTGTAAAATCTGCTTGACCCGAGTC
AGCAGTCCCATATATTCGGGCGACCTTCACGTCAATGCTTTTTCCTTCAGCTCCATGAATTGTCGATTCAACAAAGCCAATTTTACCAGGTTTTCCGTTA
TCCAAATCGTACGACTGGTTTACCCAAGCACTCGGTCCTCCATCGCCAACAGCCCTTACAGACACAATATATGTATTCCCATTTTCAGTAGTACCAATAT
TGTCAATTGAGAGGGTATCTGGACAATCAAACTCTTGACCGGCCACAGAACAGCTCAAGGAGTCTTGGAAGACAGCGGTTGCAGTAGTAACACTTGTAGC
AATCACCTCAATCGCCAGTGGACTCCCACCTGCAACGGAGGGAGGAATCAGTGATAGTTTCAATGCTGTTGCAGTCACAAACATCATTGTCGTATCAGGA
CTTGAAGGAATCCCAGTTAGAGTGGTGAAGTTCATCGCTGACCATTCTCCAGAAAGTGTAGAACTCACGCCTTGGACCTCAATACGATAATCATTCGAAG
CTTCCAGTCCAGTGATGCTGATTGAACAGCAATCAACCAATCCGTTAGTTAATGTAGTTTCATCGCCAACGTGGAAGACACGATAGGATAACGACACACC
TCCATTTGCGCCACCGTCGTCGCACGGAACCGTGACACCAAATTTCGCGGTTTCCATCCCCACGTAGATTTTTGAAATCGCCAAAAGTCCCACAGGAGTT
GCAGCTGTCGTTGTAAAAGTAGAAGTCGCTCGATTTACAAACCCAGCAGCATTTTCAATCTCAATGGTATAGGTATAATCCGTGTTCGCCACAAGGCCTC
CACAGTGAGTGTAGGTCAAGGCCGATTCCGTATTAAATAACTCGGCTCCATCCACGCTAAGGTGCATTCGCTCGATTGATACACCTCCCGTATCCTGAAC
GCAAAGAAAAACAATAAAAAATATTAGTTGCAATGTGTGCCAGCATTCATAAGGCTTCGTCGTTACCGCTGAAAGCTCCCATTGCAGAGTTATTGAACCT
CCTGTGGCAGATACAAGGAGAAGCCGAGGTACTCCTGGCTGTGTAGTTTCAGTTGTGGTGACGGCAATGCTGTTGGAGAAGGGGCCTTTCCCGACGCTGT
TCTTCGCAGCTATCGATATGACATAAGTTGTGAGAGATCTCAAGCCTTCCACGCGGTACGTTCCGGTTTGAGTAGTCGAGGTGCGTGCCTTCGTTTCGGT
TTGTACATGTAGAACTACACACTTGGTGTCAGCATTTAAATAGCAATCGACACCATCAGCTAAGGAACACGAGATGCTATCAACAGACATGACAGCGCCA
CTGGCATCCAAAGCGTGAGTGCACGTTGAACAACTCATTGCAATAAAACATGATACCAGCGTTTCCAGGCGAGCTAAATACTCGATCGACTTGAGTGTAA
ATCCACCAGTAGAAAACGGCTCGCCAAAAGTTAACTCCACGTATCCACCACTGATGAGAGTCTTCGTCACACTGGTAGGACGAGACGGTACTTCAGCAGC
TGCTGTAGTAGCGACGATAACGTTAGCATCGAAGCCGGCCAGACCATACTGGTTGATCGGAACGACTGAGAAGATATACAGTGTGTTGGCCAGGAGCCTT
TTGGCAAGATACGAAGTTGTTGTCGAATCACTTGATCCGTTGTAAATGAGCTCTTGAGGTACGCTCGTCTGGGAGGTGCGCTTGTAAAGTAAATACCCTG
CAGACAGCACATCAAAGATGTTACCATCCTACCAATGAAAGAAGTTGCTAGTAAATGCTCGTAAGACGTTACCTGATATAGCACCTCCTCCTGTATCCTC
AGGTCCTTCCCATCGCACAAACGCCAAACTGGAACTAGCATGAGCGACTATCAACGACTTCAAATTCCCAGGTGGACTTGGACTCGCCGTTGCAAATTTT
AGTGCTTCGCCAAATCCTGAATCACCAATACTGGTCGTGAAAGCAGCTCGTACAGAGTAATTCGTGTTAGCTAACAGGTTTCGAATCGTAATTTCTCCAG
GGTATAACGGGACTGCGAAGCTTTCATGCAAGACTCCCGTAGACAAGAAAATTCCAATAGTTAAGCCTGTGCCACCGGCACCGCCGAGATCATCTGGGGA
TGAAACAGTCACTAACGCTGTGTATCCGGATAGTAATAGCAGAGCTGGGGCTGACGGTGGGGCGGGAATAACAGCGTCACCTGTAGTTGCAGTTACGGTG
TCACTCGCTAAATCATCCGCAGTCAGGGTGTCGCACACAACATTGGCCTGTAATGCCAAGGCTTTGAACATGTACGACGTTTGAGAACGCAGAGGGCTTC
CATCTGCGTCTCGTGTCATCAAAGCTGTTGTTGCACTTGTACTTGATACTAGTATACTTTTCAGCTTTTTGAACGAGCCATCGTAGAGAATAAACAGGTT
GAATTGAGCAATTGGGAGGCCGCCTATCAAAACAAAAAGTTAAAAGATCTTTTTGCAGTTTGGTGGTACATCATAGATTACCTGTATCAAGAGGTTCATT
CAGTATCAACTTGATTGATCCCCCTGCGGAATTAAAAAGAAGAAGTGAGACGGAGAGGAGGATAGCAAACTAACACTAGGAGTATGTACCTGTGACACCA
AATATTAAAGGCAACGGTGTCTTGCTTGGACTTCCTCTGTTTCCGGTTCTTACCGACTTCGGTGCACTAAACGCACTTTGAACTCCATTTTCGTTAATCA
CACTGAGACGGAAAACGTAAACGGTGTTGTGGCGTAGCTTGTAAACAGTTGCTGACGCTCCGTTGAGTTTAAACACGGAAGACGTGAAGGATGTCGTAAG
AGCTTCGCGTTGTTCGATCACTACCACAGACGATCGATATTCAACAGCCAAGCGTGTGCTTTCGTCCAACACGAGGTCCACGCTTCCACCAGAAACATGA
TTTACGACAGGCTGCTGCGGAGGCTGCGGAGCAGGATCACTGTACAAGCCATCTAAGAGGAGGCTATTGCTTTGACTGCCAACACCCTGCGCGTTTTCTG
CTCGAATGGTAACTTTGTAGCTGCTTTGCATCTCTGTAAAGTTAAAAGTTGTAGAAAGATTTCCACTTTCTCCAGCTTTAACACCATCGAAAAAGATCAA
ATATCGCAAAATGTTGGACCCTCCATCGTCATCTACAGGGCTCCAGTGAAGTTCTAGCAGTTCGGCTGAGCGTTCCACCACACCGATGTAGTCCACTGTC
CCGGGGACTGTCACGTTTGACGTGCTTGCAATTAATTTCTGTGTCACTTCGTATTCTTTGCCATTTTCAGTCACAAATTCAACCGATAGTTCGTAATCGG
TTAGCGGTGAGAGCCCGCCGATGCCAATAGAGCCTTGTCTGTACATGCTGGCGACTGTCGCTGTGGTCTTGGACCCACACGTTCTCAGAATTCCATGAAC
TTCACATGGTTTATCGCAGGTATTTGGCGTACTGCTGGCGGTGGATGCAAACAAACTGTAGTAGCAACTTCCATCTCTGCTAATCCCAAGCTTTTGGATC
GGCCGCGTCTTCGTAACTTTCACATTTTGCACCATAAATTTCGCACCGCTTGAGCTTCCATCTGCTCCTGATGGGTACCAGTTCGTAGTCTCAGCAGAAC
TGAAAAGGAGAAGAAGAATCAAATCAGGTCCGGCAACATTTGGCTGGTACGAGGCATATATTTCCGCTGGATCGCGCGCCACTTTCCATACTCGAATCTA
GATTTAAGAAAAAATCACCAACGTGTGAGTCTTTTATCTTTTCCGTGTTCCAAGTCAAAATATCTTACCTCATCCATTGAACCTTGCAGTGCAGAAGAAT
CCGATATAATGTTTAAAGCATCTACTCATTAAAAGAAGTCAGATAACAATACATGAAGGTGGGAGAGATTTAAATCGTACCTCGACCAAGTTGTAGGTAC
GCATAAGTCGGTATCGGGCAATTTGACTTGCTCAGTAAACCTTCAGCCATCTTGACTCCTTGTATAAAGATTGTCACCTGGTTGTCAGCGCTAAACACGA
ACGCTAGGTGGGTCCACTTGTGTAACGGAAGGCCATGCGGAACACGAAGCTGGTTGTTACAACGTGAAATAACCAGTTCGCCGTTTATCATGATACTCAG
AGTCCCCTCTTGTGAGCCGTAGAGAAGTAGAAGCTGTTGGTAAATGAAACTCGAGCTCAAGTTGTCCAGATACACCCAGAACTCGATCGTAAAAGCATCA
TTGATCGGAACAGCTATCATCTGCGCGCTCCGCACAATTGATTCGGACGTAAATTGAAGCTGTGTTTCGGTAGCCGAGCATAAAGAATGGCATTGACTTG
GACTGTGATACGAGGTCCCCGAACTTCCGACACATTGATACATCGGCGAAGTAAATTCACAACCAAGATACTGGAATGCATCGCCTTCAATAGAATAATA
GTTAGACGACAGCAGGCATAGTGAAGTAAATTTTAGATGTTTACCTGTGAAGCGAAGAGTTGGTGCCTCATTGTTGCCCGCCTCTTTCACATAAGCACGA
TAAAGAACAGGGTCTGGAATGGAATTCGCTGTGACGACCTCGACGTAGATCATCCCCCCTGTGGCGCGAATAAACTGGATCTCTCCAACCATACTCTCCT
GCGTGTAGTCTCGGATCGATATAGTTTTTAGGTATATTGCGTCTTCTTCGGAAACTTCGCCATGAAACACGATTTCGGCTGTTGAAACGTACGGCAGTTT
AATCAACGCCTCAGCATAATTCCATGCGCTTTCAGTAAGAGGGGCAGAGTCGCTAGACCACAGCCGTCGGGTCTCGGTTGAGTTTAATACCACATCGGTA
CTCATACTAGAAAAACCTGTGGTTGGGTCACAAACATTAGGAACATTTCGAGACAAAAGAAAAAGTTAAATTCGCGTACCTGACGACATTTGATACCTGA
ACGAGAGCGTGGAGTCACCTCGAAGCTGTGTTGGCAAACTTCGGTAGACCGCTTTTCCTGCACCGGTAGGTTTACTTAACGAATCTGATCGTGGAATCCA
CTCGATATTTACCCCACGAATCGTCGCTAATTCGGCCCCCAACTCTTCAAAAGGATCAGCATTGCCTACCATGCCAATAGCAGATACGCTCACATCAAAC
TGGAGCGTTCCAGTAAAATTGCCACTTGGAGTGACTGAAAGTATGACACGACTAGCACTTTCCATGGCATCATCTCGCTGAACGAGCACAAAGTAGCGCT
GGTCCTTTGGCGACGGGGGGTACTCAACGCCATCCCTTTTGAGGATGATGTAGTCGTCATCGGTCGTGTTCACTGCTACAGCCAGCGTAATATACTCGAT
GTCTGGATTCATCATCGTCATCGTTGGGATTGTAACTTGAGCCGATGACCCTTGAACAACTCTTCGACTGAAAGAGTACGGAGTAGCAAACACTGGTTGG
GAAAAGGAAGGTAGTACTGAGACCACAATGCTCGGCACGAAGAAGCAGCCAGTGCTGTCATTGTTAAGGCCTTCCCACTCCACGATCACATCGACGAGAA
AAGGTCCGTACTGCAATGGCAGGAACGAATAATTCTTGCCAGTATCTGCGTCTAAGCTCACGATAAAAGCGGTAGCATTGTAATACTCCACTTGCGCACG
ATCATTGTTGACGAACAAGTTGCCTACGTTCGACGCCAACGTGGAGTCCAAAACGAAAGAAACGCTTTTCAAAATTAGGGAATCGAGAAAGTTGGAGCCA
AGAACTGTAAGCGCGATGGAAGAGAGATCCACAGTATTCACGTCACCCTTACGGAAGATTAGTGGTCCTCCTGTCGTCGGTGTTAATCCGCAAAAGTATA
CAGTGTACAACAGAGCACTAGAGGAGACAACAGTCCAAGACGTTCCATCTTCTCCTTGCGCGTTCTGAGAAGTAATCACATTAATGTCGACGATCGCGGG
GAGATCTTGGCGCTCAGTGATTTTAATTCCACTAAAGATAACGGGTTCGATCGTGCCAACGTCTTTCAGTAGAAAAGTACATTCTTCGCTTGTTGAATTT
GCAGAGCCCACAGCTACAATGTCGAAAGAGGAGCAATTCGAGACCACGATCTTTACACTGGACTTGGCCAAAGCGACTGAATAATACAACGTCAGCTCCA
ATACTCCGCCAGCAAGTACGTTATGGGCACCAAGGAGGATCTTGCTTGGAAATGACATTTCGGCTTGGGAAATCACTGACCACGTAACAGGAATGCTGGC
AATAGCTAGTATCGTGTCATCTGCATCCGTCATCACAACTTGGATCTGAGCCTGTACGTGTTTCACACTTGCCAGTAGCGTAGCTGATAACGTTTCTTTG
CAGAGATGTTTGAGAACTGGGTTATGAGTGCCGGTCACATATTGGACACCTGTCCAGGGTGTTGCCAACATTTCAATGGCGTTGGATACCGAGAAGATCG
TGAAGCTCGTCTCACAGAACGCAGCGCTTGTGTCTGGCTCGTTTGGAAATAGATCCAACGCCGCAAGGCGAAATGGCTCGTTATCTTGTAAATCGAAAAC
AAGCGATTGCAACTCCACACTTTTCACGTTAGAATTTCCTGTGTCCACACTGTCGAGCCTGCGAACCTTTTTCGTATCAATGCCAACTTGTAAAGCTGCG
TTCTCTGCTTTTAATTGAGATTCCATTGCACCGCCAATAGTTGAAAGTTGTGTCTGTGAATCCGTTTCTACAGTCACGAAAAATGTCTTCGAGTATTGCT
GCATTTTGCCTGCGATTTTGATGCCCACTGTGACTATGAAGTCGTGTCTTTCTGTAAAACCTGGCAAAACAAAAACCTTCATCGCCGCTTCACGACGTCG
CAATCTCCAAATCGTCACAAACCTGCCGTCCAGTGCTTCTAATCGAGAGGAGGCGCCACCAATTCGAGCATAGTCAAAAGCACTGTCGGTACTCCAGCTA
ACCTCCGCCGATACAAGATCAAAGCTATCAATCCCTTCGAGAGTTTCTTTCACACCGTCCAGGACATCCTGGAGTCGAACCTCCACCGGTTCGCTTGAAG
TAGAAGCAACTATTCTCTCGTCACTAGGTAACGCAGTTCCAGGTTGTAAACGAGATGAAGCAGTCGGCTGATAACTTGGACGCCCAATTACTGCAGGAAA
CGACGACAAAGACCGTGGCTCGAATTTCAAGCGCGTTTCAGTTTCTGTTAGGCGTCGAAATGCAGGGGTAGAAGCTGACTTTGCTGCAAGAATTGGCTCA
TTGCTGTCTTCCGCTAGGAAAAGCACGCCAGAGCTCTCCTCCAGGTCGGCATGATATCCACAACGCCCAGCTAAATCAAACAAGCATTGGCTTAGAACAG
CACCTAGAAGTCAGCAAGGCGTTAGTCACCAGTCGCTCCTTTATCCATTCATCTTTGTAAACCACCGACCAATTAGAGACTCCGTCACAGGCACAAACCA
TAGCGACACAATCCCAGAGCTCGTGTCGTCGCTGCCCACGAAGGTAATGGAGCGTGGAGTTGGAGATGCAAAGAACGTAGTAGGATTTCCATTCACCGTA
GTCTGCACTTCGAAAATCCGAAGCGAAGTCTTCGCTGCTGCTTCAATCTGTTGGACGAGTCAAAGTACCTGTGAGGTGCTTACATCCACCTGCATTTTCC
TCCAAAACGCACCTTCACTGCCTTCACCACAGCTTCGTTATCCAGTGGCAGTGTCACCTTTGAAATCTTCTTCTCGAGAACGTCACTCGACAGTTCTACC
GTCTTCAGCTCAACTTGATTCTCTCCATACAAAGTTACATCAAGTGATCCAGTCGAGCCTGCAGATGAGCTACGATCGCTGACGAGATACACAGTTACGA
CTGAAGGCTCAATGTTAGTGTTCGTCACGTATAGGCGAAATACAGGCAGTCGACGTACCATTACAGAGATCCCATGTTCGGCTGAGGACACCGTCAGCAC
AGGGATCCGACGGGTTCACCGCACACCTGAAGGCTGAGCTGGCTGTGTCCTCATAGCAGATTACGCCAGTATTTACGCTCGATATAACTCTAGGTTGGCA
CGCGCAGCCTGACTGCGAAACGACCTGTGGTAGAACTGGCTGGGACAATACGCAGACCGCCAGGACGAGCACGTGCAGAAGCATATTATGGACTAATCTG
GCACGAACAAGGTGTAGAATGTGGCGCAGCATGGGTGCTCGCTGTTTACTAGCGCGAGTCAAAGGTCGGGATCTTCGGTCGCGGGTCACACCGAAGCAAC
GGGCGGACAGGAGTCTCCCGTCGGAAGACCATGGAAAATCGGAAAGAATATGATAAATATTGGGTTTTGCGCCACAATAAAAAATTGTCTGTGGGCCTTT
TGTAATTGCAAAAATATTAATTGTCCAGACTCCTTCCCTCTCCGCCAATGCAGCGCTTCCTGCCTCCACGGCCGAAGCCTTCGGACCGAAGCCCACCGGG
TCGCGCTACACCGTACAGCAGGTGTGGTCTCCTCAATGCGTAGTGCACCACCAAATGTCGTGGTGAGCGTTGTGCCAAGTATCGACAGCTTTGTTTCTTT
TAAATCTTCTCCGTGCGCCAATTGTGGGGCGTGTGGTCAGGAGAACGGGTCGGAAGACGGAGCACCTTGATTGACGCTCGGAAACTGTCGTGCCGTTCAC
TCGCTATTCAATGGGGCAAAGTGGCAGGTTGGAGCCACATTACCGCCCCACTCATCAGCCTGGAGCTCAAGCTTTGAGCTTTGACGGTTAGACCGAGGTC
ATGCCAACAAAGCGGTCTCCGACCCGTTAGCTGGACACATCGGCCATCTCACCCTGATGCAGGCACCTGCAGGCAGGCGGAGACGAATACGAATATCTCT
TGACCATGGCATCCAAAGCCAAAAGCGGCAAGCTTTTCCTGGACTCCATCTCCATCTTGAAGCAGCAAGTAGCCATCTCCTTGCCTCTGCCCACACACCG
CGAAACGGACTCGAGTTCGTGGTCGTTGCTGCGTGCTCCGTTCGCGACGCCATTTTCGCACTGAAACTCGTTTGCTGGCCTGGAATCTGACGCACAGGCG
CTGCTTTCGTCAGAGTGAGCGTCGCTCACTCTGACGAAAGAGGCTGCATAGGTTCGCGCGCTCGTCGTCTCATGCTATTCCGCCGCGACGAACGTTACTG
CTGCTGGCGACTATCTTCTATCCTTCGGTAGGCGTTCGGGTCGTTATCGTCGATGAGTGGGCACTGAACACCGGCAAGTTGAAGCGCACCGGCCAATAGG
ATGCTTGGAGCGTTGGAGTGAGTTGCACTAAGTAGGCCGAGCGCTTAGTACACTCCGCTGCCTTGATGGTACCATCGAGCCCGCTTTGACTTGACTGTGC
GTCCAGCAGTGGCGTTCGAAATCAGCTCTTGGCCATCGTCGCCATGGCCTGTCCTGGTATCGAGTTATGGCTCCTAGAAAATCAAATACTAGCGGAAAGC
AAGCGGATACTGCGCTCGCGACGGGTACGTCAGGGACAAAATAGAAGGGAACTTGCCACTGCTCACTAGCCGTTCGCGCTAAATAGAGTTCAGGCGAGCA
CGTGCGTCCTGACTGGGCTGTTACGTGCGACGAGAAACGGTGGGCACCCCATCCTACTTCGGCCGAAATCGCTCAGTTTCGCATTTGAGTCTTCTGGCAA
ACGTCGCTTTTTCAGGCCCCCTCGTTTTCCTAGGCGATTAAGCAGCGCTCGATTAAATACAGATACCATGACAGACTACAGCCCTGTGACTGGGTCGCCG
CTGACAGGGACCCCGTTGACTCCTCGCTCGCTCTCCAGCTTCGGCTCTTCGAACGGATCAGAGGGTACCGACGACAGTGATGCCGATCCTGCCGAAGTAG
CCACGGAAATGTGCGTGAAGGAGCGCGAGCGCCTCACGACGGTGGCCAAGCGCATGACAGAGAGTCTCCTGGAAGCTACAGACCTGCTTGGAGGGATTCC
ATGGGGGTTGGTGCACGAAAAGCACGGCATCTCGCTCTTTCGCGCCGAAACCACCAACCGCGGCACCAACGTGCCCTGCAACGTCCACGCCGTGTGCAAG
TTCGCCTGCAGCATCGAAGACGTCGCAGCGTCGCTCATTACGCCGACGACGGCGTCGTTCAAGCGGATGATGGCCATGCTGTCGTCGGATTTCCTGGATG
GTGCGGTGGTGCAGAACATCGTGGAGCCCACGCCGACGAACCCTCACCGCTACGTCGCTCTCAAGTGGGCTGCCTTCAAGAGCTCAGGTACATTCGCCAA
GGATCGTGACCTTCTCATGCTCGAGTACGTGGACATGATTGAGGACGCTCAAGGACAGATGACTGCCTTTCGCATCATGGAATCCGTGGACGCACCCGCG
GGGTTCGAAAAGTACGCTGAATCGCCCAAGTTTAAGCGCGACCTCGTTCCGCTGATGGGCTTCATGTATCACTCGACCAAGCGCTCGGGTGAGCTACGCA
TGACGTACACGTGCAACTTCGATAACGGTGACCTCCCTGCGTTTATAGCCAACTCGGCCATTCAGTCGCACGTGGAAAAGTGCATCAACGGCATTCTCAA
GTACACGGAGAACTTCCGCGTAGGTCGCGAGGAGATCGTTCTCCCCCAACAAGTCGTCCCCATGAGCGAGCAGGACCACTGCAAGATCTGCGCCAAAAGG
TTTTGTGTACGTCGCCGCCGCTACAACTGCCTCAAGTGTGGCGAGGTGTGCTGCAGCTCATGCAGTTCGGTGCGCAGCGCACACGTGCCGGATATCGGTG
AGCGCCAGCTTCGAGTATGCACGGCGTGCGTCATCCAAGCGCGCCAGTCCTCACGCAACACTGCCAGCGGCAAGGACTCGCCGAACACAAACACTTCGTC
GCTTAGCTCCACCAGCAGCAACCAGTTCTTCTCCGACTCGAACGAAAACTCCCCCATTCTCGGTCGAGCAAAGAGCTTTTCAGTCTCAAAAAATGAATCA
AACCGGCCAGCAGCCCCGAAGCGCCGGTCGTACGATGATCTTCTAGACCCGGTGCGCTCCAGACTCATCGAGTACAAGACGTTCTCGTCAGGTAATGAGG
AGGTGCACGGTTTCGACTCCACAGGTTCATCTATCGGTGTGCCCAAGGCAAGCTTTCCAAGCCGTTCTTTCAGCGACGGCCTCGTCATGCGTAACAGGGC
ACTTTTCGCAGCTAAGCGCCGTGGCAGTCCCGCAGACCTAGCTATCTCGATCGAGGCCTTCCGCCTGCGCCAAATGCGCATGGGCAACGCAGGGCAGCAG
CCTGAGGACGCTCTGGACGAGAATGACAACACCGATGACGAGTCTACCGCGTCGTCTTCGTCCGTGTCGCCCACGTATTCGATCACAAGAGCGTCACCCC
TGCTCAGGCGCGCGTCACCTCCGAGTCTGCACCCTGGTCGCTTACGCATCCAAGTCAACCATGAGAACAACCAGGAATCGCCAGTGGGCGAAGGCGAGGA
GAAGATCGAGTTCAATGAGGCGATGGCCCGCTCCAAGGACATCATTGTGGCAGCCAATTACGCGAACAGTTTGGCGCAACAAGCTCGAAAGCTGTCACAC
TTCCGCGTGGTGGCGCTGCAGCAGGAGCACGAATTCATGGCGCCCATGCTTCGCGATGGTGGCGACAAGGGCAATAACAACAACAACAACAACAACAACA
ATAGTCCGGTGGTGCGTCGTCGACCGCGCCACCGCCGCCACGGCAGCGATTTCGAGGTGGCTCAGGGTGCGGGGACCGTGCTGTACTCGAACTAAACAAA
GACGCTGTCCGCTCCAACCTGTTGGAAGAAATATGACGACGGCAACGAAAAACCAAGTATCAAGACGCACTTGCGGCCGGCCGTGAACTAGTTAGTGGTG
AAGTAGTGTACAAAAATATTGCGCGGCCGCAACAAGTGCAGATGTGAGTCAGTATGTGGACGAGAAGCATGTACACGCGCGTGGAAAGGAGGCGACGCAG
GGAACCACGGCTCTAAGTGACCTTGCATTATTAGTATCGTAGTATCGGTAAGCTTAACATGGGTATTGAGCAGCTTTGTAGCACTCGACATTCCGAGTTG
AAGTCTCCTGTTGACACGCGAACTCACGACCCCCAAAGAAACACGCGTGGTGATGCAACTTCAATTCTGCTTGGGACTTTTGCAGGGTGCAGCGCAGCTT
GAACACGGTCTATGTTAAAGCTCAAGACAGGATTTGCGATGCGGCCATGGCATGATGCCACGCACTTGCGCCAAGGCTTGGTGCATGCGGTGACCAAGCT
CTATGCATTTACTACATTCATATTCATGCGGGGCATCAGGACTATACGGCAAATGCGGTCACGTTGGGCGTTTACATATTCAGCCGGTATTAATGGGGTC
GCAAAGCTTACGAGACTGTTTCTAGAGATAAGCTTCGATGCCAGCCGGGTTCTAATGCACTGCACACCGCAATCAACACCATGCTTGCAGCGAGCCGAAA
TAGAGAGGAATTACAGGGCGACGCAGCGCAGCTTCTACCGCTTGTCGAGGCGCTTTGTCCTGAAGAGGGGCTATGATCCTCTCGCCGCTTCTGCAACCCC
CACACTGCACTAAGAGCTTACTGCTGGGGCTTGCCGTTGTACAGACTCTTGGCGTAGTCAGGGAAACGGATGAAGGGCGGGTACTCGTTATTGCCCTTGC
TGTCAGAGT