Description :
From Genome Similarity Track
Location :
Scaffold_40:1118194- 1126211
Sequence
8017 bases(100 bases per row)
ATCAAATGACAATTACGCAGAAAATTGTTTTCACTATTGGACATCAGCACTCAGCTTCACGTGCTCCCAAGACGGTGCCAAAGTTTTTGCGATCTGTGGC
TAATAGACTGTCTGCGGATATATTTTCGACGGTCAAGAAGGAGTGGGAGCGCTTCGTCAACCTTATGGCAGGCGCTTTGTGCAAACGAGTTGCTGGAAGT
GTTTCGTTTTGGAAGGTCAACTGTGGGAATGAAACACTTGTGTGCAACGATGGAGAATGGACATGTATCTGCTTATTCTTCAAGAGTCATCATCCACCTT
GCCGACACATGATGCATTTGGCAGAATCTGGACTTCGGCTCAATATGTTACCTGTTACTTCGATTGACAAACGATGGAGTTTGTCGGTGGCCTTAGAAGC
AAAGGAAGACCTTGCTGCGGCGGCCGACTTACTGAAACCTATTGTGCAAATGTCCAAGTTAAGGTCGCCGAAAGTAAAGTTGCCGGAGGATGACAAGGTT
GCGGAACAAAGTGATGATCACGGATCCTGTATGACAGCTTCTAAGATACCCAAAGAGATTGCCTACGTTCGCCTTCACAGGAAGGAGCGTGCCAACCAGG
TGGTTTTGTCGTCATCAGGAAAGTATTCATACGCAAAAGCAGTGTTAGAGCCTCTGCTGGAACATTTATCGTGTCTATCAAGCGCTGATTTCTATCAAGA
ACTCTCTGCCTGGAAGGACACGGTGGAGATTGGTATCAGCCGCGAAGTCAATGGTAATCGTGATGACGGTAGTAGTATCGAAGACGATGACGATCAAGAC
GATTGCTCCTCGCTTGACCCACTTGAGGCAATGGAAACAGCGAAACTTATGGACGAGCTAGAATCCGCTTCGCCCTCTACAGAAGCCTGCACGGATAGTG
GAGGTGCATCTGAGTCTGAAGCATCTGAGTCTGAAGGGGACAGTGCAAACCCAGAACGCGTCAATGATACTAATATGTCGCTGCCAGATCCGGAAGTACC
AACAATTGCAAGCCGTGCTGTTGATATCATAAGCCTTCCTCCGCCTAAACGTCGCGGTAATTCCAGGGTGACGACGAAGCAGCTCCGCCAAACTACGTTG
ACATTCGGTCGACCCCGTCTAGCTATTCACATATACCCAGCTGGGCTTACTGTGACTCTTGATCGCTTTGTACGTTGGGCAAGGAACACGGAAAACTTGA
AATTTGTCATGGATACACTTGCCAAGTATCCAATTCAGCTTGAAGATCCCTATTTGAGAGCCCGTAGCATCGAGTGTCGGTGGGAAGCAATGCGGCACAC
GGACTACATGCACGCATTTGCAGTTCCAATTGATATCAGTCGATCACTCCAAGCCGCCGTCACGACAGCATGGATAGAACAGGACTCGCCGGGTCCACTC
GAAGATAGCGTGAAGAATCAAGGGATCGTCCTTGATATTGTCGCCACTATTGATCCGAAACTCTGGAAGTTTAGCAGGTAAGGTTGTTTTACCAATAAGG
TTGCCATATTATGGTTGCTACAACCGGGTTGCACTAACGGAATGGTTGCTCTACATCTACAACATCTCGCAGCAAGCTTGTAGGAGCTTTGACTGTATCC
ACGATGTCAAATTAGAGGGACGAACGTGGATTGAAGACCGGAAATGGCTAGAGCAAAACTGGCGAATCATCCCATCAAATGTGAGCCTCTTAGAAGAAGA
GACAAAGACTCAAGGCTTACAAGAAGTAGCTATTTGCAATCGACATCAAGACTTGGCCAACGAAGTGATTGGGAAGTTTGCATCAAGTCGCTTACTAACG
GAATTTCGGACGCTGCACGGAAATGGATCGATCACTTTCGAAAACATTCTCGGTGGTCTATGTCGGGGCTGGCTTAATGACAGTCACATAGACTTCTGTT
TACGAACAATTGGAGGGGTTGTTGGTGGCTGCTACGTGATCTCGTCACTGATGTGGGATATCGGGTGGCCTTCTACACCAAAAGTATCTATCGGAGAACT
TAACTTTGTCCTCCACGCAGTACACCTGGACGGCAATCATTGGGGAGTCATTATCACGCGTTTTCACACGACGGCAACTAGTGTACGACTATTTGTACAC
ATGTACGAGCCTTTGATTAATGCTTCTTATCACAAGGACATGATGAAGATCTGGGAGGGTGTTACTGAACAAGTGAATCACCCAAAAAGCAAAGCAAAAA
AGAGCCTACGCGGGTTCCTCGAGCGGTGGCACGCGTCCTCGATGCCGGATGTGGAATTGGAGATCCAGGACGTTGAGTGGGTGTTTTCACCGCAACAACC
AGATGGATCTAGCTGCGGCGTATTAGTTATAGCACAATGCTACAATTACCTTACTGGAAACACCACACAACAAAGCTACGATGTCACCAAGCACGACATC
AAAGTGATGCGCCTACGAATTCTTTGGGCCATTATACATCTGTCCAAGGAACAACCTATCTCCGAATCCGACGCAGCCACAACAAGCAAGACTCTACAGA
ATCTACAAAAAGAACTCGAGTAAGTGTTTTAGCCTGAATTAAGTCTTTAATACAGACCGTGTTCACTGCATTATGCATTCAGCTTGTGAATAGCCATCTC
CAATAAAACTCCAAACGAAAGATCGTCATCTTGAGCTGCCCCCTCCTCGAAGAAATCCGCCTTCAGCTGGTAAAGGCAAGCTTCCTCCTCATCAATACGA
CCCTGAAACTCCATCTGAGCTGCCATGATTTCCTCCATACTGCGTTGTATGTTAACGAGCACCGTCCTCATCTTCTCCAGCTCACTAAGCCTTGCACGAA
CCAACTCAAGTGGTAAAGCCTTCTGATCCATAGCGATGATCGAGATCTTCCAGCAATCGAGAAGTCCCAAAATGTGCGAATACTTGTGTCCCACATCATG
TACATGTGGCTCACATCAGTCTAGAACCTCTAAATTAAGACAAACCTATCGACGAAGGCCACGTGGTCTTGGGTAAATTAAAATATAATACCGAGTGCAT
GCCCCGTTGTGGTTGCGTTTCGCTCTAAAGTTGCCAAAATTCGTGTCGTGGTGCTGTATTTATATTTGCGGTAACGCCATTCCTTTTCGTTAGAATGGAA
TGTACAAGCGTCGAATAGTTATGTATTTAAAACCTCGACTATCGCTCCGTTTCAATAGATTCCTCATTCATGCTACCAAGAGATAGGATTTCGCGAAAAC
ACATTTCTGCTGCGCCACCCCTTGCTAGCTCTCTTGCTGCTCTCTGCATCTATCCAAATAAGCTCACTTCTTTCACTAACAAAACAACATCATGCTATCA
AATATGTCACTCGTTATTTCGCCCGACTGAGGTGACATAGCATCGACTTTTATACGTGTACATATAGTATAGTATAGTACGGTTAAATTGGAGTAAAGGT
GACACTAGCGCGTTTGCACTCGTCTGCGGACTTATAGCCGTGGGCCCACCCCTCTCTTCGCTTGCTGCGCTGCGCTCGGGGGGTGGGTGGGGGGGGGGCA
CTGCGCGACCTGCCCCACCCCGGCCTCTAAGTCCTCGACTCGGCAAGGCGCTGTGTCTGGGATTAGAAATTAAGTCCGAGCGAGTGTTGCCAAGACCGTC
AGCTATGTCCATTTTATGCATGTTGGGGAGTATAATTGTCTAGTCAGTCAGCCAGTCGGGCGAAATACTCACTGTCATCAAATATTTAGCCAATTATAAT
CAAATATTTCATTATCAAATATCAGCCAATCAGGATTATCCGACTAAACCTACAATTATAATCCCTAACATGCCGAGGGCGGCATACGGCAGCGCTGCGA
CAAAGGAGTGAGAGCTGTGTGAGAAGGCAATACCATGCACTAACTGTTAAAAGGTATGGGCAAGCAGAGGAAGTAGAAGAGACAGACTTGAGCACGAGGA
AGTACGTTTTGAAGTGATTAGAATTAATTACAAGTACCTCGGAGTGCGCGCTACGCCATGGCCTCGTCGGTCGAGTAATGAGCACCTGTCAGCTTTCTGA
TCAACGTACTTAGCGCACACACTCACCAACGGGATCACCATTAGCACCAAGCGTGCCTTTTAACACTCCTTCCATCACGTTGGGGTGGATCAGCCAGCCT
CGTTCTCACTCGCACCCTCTGGTTTCTGATTACCTCCGTGTCCACCGCACACAGCTTGTACAATTCACGCAGCCTCGGACTTGCTGACTAAAACGGCTGT
GGAGAGCACCATTGTACTGCCGACGTACGCCGGTACAATGATGATGCCCTTCGTAGCCAAATTCTTGATGAACTTGTACTTGACATCAATGTGTTTTGCT
TTGCTAGAGCTGGGTTTATTCTTCACCTGCTTGATGGCCGCTTGATTATCCATCTTCATCGCCACCCGCTCTACAACGGGGATGCCAAGCTCGTGAACGA
TCTCGCAGCAGTCCCAGTAGCTCTCGTGCAACATGAGCAGCGGCAACGAACTCTGCTTCCATGACCGAGAGAGCCACGATCGACTGTTTCTTGCAGAGTC
ACCCCACAACTGCGTTTTCCTACTCATCATGACACCGCTTACAGACTTGCGGTCAGTCTTGTTTGCCGCGTAGGGCGCCACGGTAGCTATAGAGCTGCAG
TGCGTCTGTCACGGAACCAATCACATCGGCGATTCGCATAACCTCTTTTGTGCCCTTCAAGTACCGTGTGATACATTATGCAATCATCCAGTCGCTCTTG
GTCGGCGCATGTATGTGTCGCGTCGCCTTGTGCACCGCATACGCAATATCCGGGCGCGTCCACATTGCCAGCCAGAGCAGCGACCTCACGGTCGACTGAA
ATGTCTTGACAGTAGCGCCATCGACTGTGCTTCCGTTTGGTAGTGGTGTGTCGCCACCGGGGAACTCGCTCTCGTTCTCGGAGGCGATTGGGGTTGTGAC
GGCATGCGCATCTTTCAAACCGGACTTGTCAAGGAGCTCGTCAATTGTTGCTTTCTGATCAAAAGCGTATTATCTATTGGGCACGTGTCTCACTCACGTA
CCCAGAAGCTTATTCACCATACCCAGTCCTTGATCTGTAAGGTCGCAAGCATACTGAACAACGCGTTTACTCGCTTTTCACTCGCTCCAGCGACGAGTAG
GTCGTCAACGTACATGCCTAGAATAGTCACGCCCGATTAGTCAGACCTATAGTACACGCATGTGGCCGTCATACACTGCACAAATCCTCCTTTGATGAGT
TCATCATGCAGCGTCCTGGCCCACAGACGTCCAGCTTGCTTCAGCCCGTATAGACTTCGGCGAAGACGTACTACGACATTATTCTTGTTGGTTGCACCAT
AATCGTGCAGTTTGCTCAAATCTACAGTCATGCCCTGCGGGACGTGCTGATAGACATCTACCTAGACGTAGATATCATTGTCAGGCTCTGGCTCGGCCTT
CATGTGACATTTGGGTATGTCACCGTGACGAGCCGGAACCCCCAGAACAACGACTGTACCGAAATCACTTTGGTGGAAGTCACGTCCAGGACCGCCAAGA
ACGTCACTGTGTAGTTGACACCGAACACTTGCTCGTTTCCGCAGGCAACCAACCTCGCCTTGCCACTCGCGTCCGTCTTTGTTTTAAGAACCAACTTGGT
GTACAGCGGTTTCATCTTGTGTGTTCGTGCCACCAGCTCCCACGTTTAGCTGTCTTACAGCCACGTAATCTCTGACGCCGCAGCCGCGCGCCACTTATCA
CGGTCACCGGAATACATGGCTGTGCTCAGTTTTTGGGATCCTTGTGGTACACGGCACCCACAATCGCACGCGCCGGTACCTTCAAACTATAACGGGCCAG
GTATTTACTCCGTTACTCGCTTGCACTATAGATTTGAGGAAGCTCGCAATAGAACGACTGAGTCTCCGGTTTAAGGAAAATTCAACTCTGACTTTATTTT
AAGACCAAGGCCACAACCCTGGCCACTCAAATACACGTCATAGTTCAGCTGGATAATAATGGATCTGGCTCCCCATATATCAGCCAATGGAATGACAGCA
TTTGAGCACACGCTAGTCGAATGCTGATGCACCTATTTAGGTAAAGAAATCTACCTATTTAAGTAATGGAGGGGCCCGTTTGATTACCCCATCTTAATGT
TGCACTTAGCCCTATTGCTGCCATTGCCACTAAATCCCTGCAATATGCTTGGTTTTACACTTTTTATTCAGCCAAAGTGTGAGGATTTTTAGTTTGAGCG
AATCATGTGGTTTGCGGAAAACCAAGCATATTGCTTGGGTTTACTACAATAATTGCAATAATTTTTGGTAAACCCAAGCAATATGATATAATATGCTGCG
GGGTGCGGAGTAAAACCCAGCATATATGCATGTTTTACATTTTTCTGTGGGATATTTACCATACAAAATCCAAGTAAATTTCCGGCAGCAATAGGGCTAA
GCAACATAAGCGTGGACGAAAAACATTGGAGAATACACCTGGAACGACAGCGGAGACGACAGCGACGGCGGCGACGGTGCTCGCGACACCAAGACACTGA
CGCCTCAGCTGGTTGTCAGTCACGCTCGGCGACGAGGGTGCGCAGCGATCTGTAACCTCGAGACACAACGTGGGAGAACGCCGGAACCGGTGTCGGTGTC
GACGCTGGTGAACTTCGACGTGGTCTCGCGAGGCTCTATTGAGGCGACGCTTCAGTCTTTACGTGGTCATCCCCGCCACCTCGGCCAGAATTTTGACGTG
TAGTCCGACTGCGTAACGCTGCTTGCTCTCGCGCAGTTCACGAGAGTTCAATTTCCACCGAGAGCACGTCGGCAGGTCCACGTTCAGCAGCCGTTTTTAT
CCGGCGAGGACGCATCAAGCAGAGCCAAGAGGAGCTGCTGACGACGTGGAACTTCCACAACGACCAAGCGCTCAAGACGTTGAATCCACGAGAAACACGA
TGACGTTACACCAGCCGCTTGAGATTTTGAATAGCAACTACGCGTGAAGATTCGCTCAGTTGAATGAGCGATGAGTTGCGAAAAGGACTGCGACGCCGAA
ACACGGAGGTTTGCAGGCTTGGACAACACTCGCAACGCTGCGAGCGACAGGAGGATGAGAAGCTTGCGAATTGCTCACGTCCCGTCGAGTCACTCACTCA
TTCAATATCCTACTAACTCACTCAATCGTTTGCTCGGCTCACTCACCGAGTGATTCAGTGGTACATCGGCGCGTTCACGCGCCGACGGTCGCTGGTTCGA
ACCCAGAGTCGACATCAACTATCTTCTTAGTTACTGCGGTGAGCATCTACGCACACACGCAGAGACGGTTCACCTTTTCCACTCACGCTTTGGGCGTAAG
TAACTTCTCGTACTCGCTCACCACATCTGGTACATCCTCCATCAAGCGACTGCGTGGCTCCCAAATATCTTCCGTCGAGGAGAGACGTAACCAACGCTCG
CGATAGTATCGTTCCTTGTTCCGCAGGGCGTGGTCCTATGGCGACTCCTAGGATTGTCCGTCGCGAGTTCCACAGCACTGGCGAAGGTCATGGTCGACGA
TTCGCTCAACGATCCTACGCTGAGCACCCGAAGAATCGATCAAAAGGAGGAGGGCCACCTCGCTGGAAAGCTGCCGCGCCACTCGAGGACGAATCAGCGT
CCGGGGTATTGGACGGATGATACTTCTTTAAACGTCTGACGTAGAGCGTTGGATGTAGCCGTCGAAGGAATGTCGAGCGTGTAGGCGTCACCAATAGCCT
TGGTTACCGTAAACGGCCCAATAAAGCGCAGCGCGAGTTTATTCGAGCCGAGGTTGGTAATCGCAGAGTTTCTGATACCATCAGCTGACAGGTGTACTCG
TTCCCCTGTCGTAAACGTAGTCGTGTTCTTGCGGCCAGTCTTGTCAGCGCCCTCCTTTTGCTTGTCCACTGCGTCCTGCAGTGCGTCTTGAACACAGAGG
CTGACCGCTTGGCGTTGTAGTACGAAGTTGGAGACGGCTGCGGAGTCGATTGGTCACGTCGCTCACTTCGACGCGTAGTTAGCTGACGCAAGTGCGCTCG
AAGCAGCTCCGGGGATG