Description :
From Genome Similarity Track
Location :
Scaffold_91:111803- 114696
Sequence
2893 bases(100 bases per row)
ACGCCCAACGAGACACGCCGTACTTCCAGTCGGCGAGCTGTAGCAGCGGTAGCCAAAGCTGGATGGAGTTGTGCAAGTAGTCGACCTATGTGAGCTGGTT
TCGTGAAAGACTGCCGTATGCCATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATACTTTTGTCCAATGATACGCTTCGGAGAGTTTTGATTGGTCTAGGCAACTGGCCGGTGATTTGATGCGGCCG
GTGATTTGATTCACCACCTTATCATATACCCAGGTTGGCCGTCCACACCGACTGATACGTTGGCACGCTTCCAGATTTCGGCGATGGTATGGCGATTTCG
ACCAAAGATTCGGGCCACCATATTTATGGCTCCATGGTGAAGCTGGCATGGGACCTTTACCACACGAAGGAGCAGGTGGTCCACGACAGCGCGGCGCTGA
TCGGACTTAAGTTCTTTCATCAAAAATCAGCGATGCGCGCCTTGATTTGCCGCTCAAAAGTGATCGTCATTCCTGCATTTCGGATGAATTCGGTAGAATC
CGAAATTTTTTATCTTGATTTGATTATGAATTTTTATGTCAACTTGCTCGTCTGGATTGAACTCGTTTTTTGTGTATTCGAGCCACTTGGATGCGTTGAA
TTGAGCTTTTTCAGCACCTATTTTCAGATTTATACAATTCGAACATTTGAAGAAATCACATCAAGTTTTGTCAAATGGCTGATTTATTTCCGTCTGGAGG
TAGTAGAATTTATATCAGTCAATCAAAGTTCCTATTGTATCTACACTGCAATTGGTCAAAACGAGTGTGTTTCTGACTTGTTATTGAAGTATACAGGAAG
GGTTCGGCTGTTCGCCGATTAAAGTGGTACGTGAGTTGGGTTTAAAACGTCGTGAGACAGTTTGGATCCTATCTTCTAGTAGAATTCTATTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGAGCTG
TAGCAGCGGTAGCCAAAGCTGGATGGAGTTGTGCAAGTAGTCGACCTATGTGAGCTGGTTTCGTGAAAGACTGCCGTATGGCATAATATAGAGTTTGAGG
AGTCTGTTTCATGAATGTTTCGTAAAGGGGTAAATATGCGTGAATACAACGCTTGCGAGTTTTTTGACATTGTATTGATACTTCGAGAAGATAATAGTAG
TAAATCGAATCAATTGAATTGAGAGATAAATCTACTTCGTAGGCAGAACTGGCTCTTTTGCTCTTCTCTATAGCACAGCATCATAATTTTCAACTTATCA
CTTGATGCACAGATTGCGAAATTAGATGAGCGGGTCGCCCAGCCTTCCAACAAAATACTTCCTCTGTTAGCTAAGCTATTACTGCCACCATGAGCAAGTC
AAGCGACCCCAAAAATCCATTTTTGGTCCAAATTTAATACGGAATATTGCAAAAGAAAGGAAATCAAAAGATGGAGATAAGTTCCATTGAGACCAAAGCA
CCGAAATGACAATTTTATGATCAAAATCAGCAACGCCTGAGCTCCACCAGATCGAATTTTAAAAATATACTTCGAGTAAAAAAGATGAATAAAATTACAG
GACCAGTCTCCATTTTCAAACTTCCCGCCATGATTTCATCACCGCGCCATAAACGCGAATTAATTGCTGCAGCCAAGCATGAAGTTGCAACCGCTCTGCA
TGACAGAATGTGTTTGGGTGCACTGCCTCGCGGCACAATCAAACTAGTTGCGGCGCAATTCCAACTCCATCGAGGCACAGTTCGGGACATTTGGAGCCGC
TACAAGACAGGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTATTGTATCTACACTGCAATTGGTCAAAACGAGTGTGTTTCTGACTTGTTATTGAAGTATACAGGAAGGGTTCGGCTGTTCGCCG
ATTAAAGTGGTACGTGAGTTGGGTTTAAAACGTCGTGAGACAGTTTGGATCCTATCTTCTAGTAGAATTCTATTAAAAAAATCTTTTGGAGGTGGTCGGC
TTTTTGGTGGTGTCTGCTTTTCCGGGGTTCACTGTATCCTCGGACAGTCCTTGCTTGCAAAATAAGGGTACTCATCACATCAATTGACTGAGGGTTCGGT
TCATCCCCGTCCTGGTCAAGAATAAAAATTGCATATTTTCTATGTTGTGTTGGCCAATCAATGGCCTCGTGTCTGAATTAGATGGGTATCATCATCCATG
ACTTTTTTCATTCACTGACCATGGAAAAACTTGATGCATACAATCAAAATACTTGCGAATACAACGCTTGCGAGTTTTTTGCCATTGTATTGATACTTCG
AGAAGATAATAGTAGTAAATCGAATCAACTGAATTGAGAGATAAATCTACTTCGTAGGCAGAACTGGCTCTTTTGCTCTTCTCTGATGCACAGATTGCGA
AATTAGATGAGCGGGTCGCCCAGCCTTCCAACAAAATACTTCCTCTGTTAGCTAAGCTATTACTGCCAATATAAGCAAGTCAAGCGACCCCAAAAAATCC
ATTTTTGGTCCAAATTTAATACGGAATATTGCAAAAGAAAGGAAATCAAAAGATGGAGATAAGTTCCATTGAGACCAAAGCACCGAAATGAATATTTGAT
GATCAAAATCAGCAACGCCTGAGCTCCACCAGATCGAATATTAAAAATATACTTCGAGTAAAAAAGATGAATTAAATTACAGGACCAGTCTCC