Description :
From Genome Similarity Track
Location :
contig_187:11180- 16233
Transcript NameFunction/comments
g14136.t1hypothetical protein
g14137.t1hypothetical protein

Sequence
5053 bases(100 bases per row)
TACGAGCGCGCCGTGAAGGAGTTCAAGCGAACCAAGATAGGGAAGGAACTGGAAGGACGGATCGTGCTGTTTGAAGCGCTGGCATCGAAGTTGGATGAAA
TAGCAGTCGAGCACGGTGTCAATCTCGGCATCTCCTGGAGCAAGCACTCGTGGTCGATGCAGCCAGACCTATCGTACCCAGACGTGTCGACTCATGCGTT
CCGCTATGTGAAATCGCAGCGCAAAGGCATAAGGGGCTGCTCAAGAGGCAAATCGAGGAAGCGGTCGAGAAGCTGCGTCCGATGCAACCCGAAATTGACA
CGTTCGTACGGGATTTCAAGACCCGTGCCGCTCGTCTGAGCGACAGCTCAACACGCAGCTCCGTGACCTTCGCTGACGAAGAGGAGAAGGATGCTTTGGA
AGACCATGGACTTGAAACGACTGCTGAAGACGAAGATATTGCTAGCACTGAGGCAACACCTTCGGTGGGGACGACTGACTGCGTCAGTTCAACATCGCGG
AAGCGCAAACAAGCACATAAGGTAGCAGAGCTACCCGACACCTTCGGTGTCTATCCCCCAGCACATCGTTCAAAGCGCACGAAGGCTCCCGCGACGACAA
CACCTCCCGCAACGACACACCTCCCGCGACGACACCTCCCGCAACGACAACGCCTTCCGCAACGACGACACCTCCCGCGACGACACCTCCCGCGATGACA
CCTCCCGCGACGGTCGAAAGCCTACAGTTCCACTTTCCGTGGCCGATGCACTGGCGAAGATCAAAAAAGAATTCCCCCAGTACGTTAAGATGACTGCGGA
GGAGTTGGTGAATTTTCAGAATCTGCTGGTTAATGGACAGCGTGCACCATCGGAGGAGGAGCTGCAGACGTTCAAGGCGGAGGCCGTCACGAACAGAAAG
AAGGGCAAGTTCGTCAACGTTACGAAGGACGTCTTCATGCGCATGGTGTCACTGGTATTCAGCACTAATCTACTGATCGAAATCATCGCGGACATTTCAG
GAGTGGAGGTGAAGACCGTTCAAACTTACACTGGACGCCTGCGAGTGATACTGAAGCGGGTGAACTAGCGCGTGAAGTTGAAGCTGCTAGTGTAGCAGGT
AGCTGAATTAAGGGGCATGCTCTAGTCTATCTCTAAGTCTCAACAAGAAAGTCATAACCTGCGCGTGGTGTGTCGGATATATGTCTCTCAGTGAGCGAAT
GCGGAAGAGCGGCGAGGCTCTATTTGTCGGCATCGTCGCAACTACGTCCACCGACAGCGAGTGCTCCACAGCCAGCCAATCCAGTCTCGCCAGCGACGCG
TCTTTCTACAGCGCGGTCGGTGACGAGAGTGGGCTGGTCGGTGGCGCAGTGGACGGGTGGGCGGATCCACTAGGGGTGCGGTTACACACTGTGGATCCGC
TCGCCCCCGTTTTGGCCCTTTCCGGACCGGAAATGGGGCCCGAAGAGCCTCCACGTGCGGTGCCGCTGCTCGGCACCGGCGACGCTTCAGCGGCTGCAAC
TTCGGGCACGGGTCCGGGACCCGCAGCGCCCATTGCACCGCGACCCCTCACGCGCCTCGAGGCCGCTGCCGGCCAAGAGACGCCCCGCCCCGCCTCCACG
ACCTCGCGTCGTTTCGGGGATCCACCGGCGGATCCACCGTCCGCTGGCGACAGTGGACGGTCCGCTGGTGCGGGCGGGAGGTCGGCGCACCCCTCCCCAC
TCGGCCCCACTATCGGCCGAATGCTGGCCTCTCAGGCCGTACGTGTAGCGGGGCTACACGTTCGGTTCACCTCCCACCTTAGTGCAACATGCACTAAGGC
ATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAAGGCATATGACTGGTAGAAAGTAATACCTTTCTACCAATGAGAGTCATTCAATA
GATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCA
CCAAAGCTTCCGTTTGGTTCTTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACCGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGT
GCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAA
TACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACC
TGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACA
CGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTC
CACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCG
TTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGG
AGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCA
AAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAG
ACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACG
CCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGG
ATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACT
GGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAAT
GAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCT
CTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAACACCTCGAAGTCTATT
GGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACAAGAGAAGGAGTTCGTCGACGAGCTTATCG
TCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTT
CGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCG
GCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAG
GGTCTCGAAGCGTCCGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGAC
GCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACG
AAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGA
AGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCT
GCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGATAATCC
TCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTC
TCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCG
ACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCA
GGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGAC
GACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGC
GCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTAC
TATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTG