Description :
From Genome Similarity Track
Location :
Scaffold_2:1117961- 1120288
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000780Similar to SLC25A30: Kidney mitochondrial carrier protein 1 (Homo sapiens)
Pytul_DAOMBR144PYU1_G000779Protein of unknown function

Sequence
2327 bases(100 bases per row)
CGGCGACGAAGAACGGAGCAGTGCTGGTGCAGGAGGAGCCCACGATGCAGCTCGCGGCGGCCGTTGAGCCGCAGTACACGCGCTTCCTCGCCGGCGGGCT
GGCGTCCGCGACGGCCGAGATTTTCACGCTGCCGATCGACTGCACGAAAGTGCGGCTCCAAGCGCAGCGTGCCGTGTCGATGCCCGTGCTCACGAACGTC
GGCGTAGTGACGGCAGCAGTAAGCAAAGACGTGCAGTATACGGGCATGGTGGACGCTGTGCAGAAGATCGTGAAGGAAGAAGGACCGGGGGCGCTCTGGA
AGGGGGCGACGCCCGCGCTACTGCGGCAGGTGTCGTACACGAGCATCTGCATGGTGCTCTACGAGCCGTTGCGCGATTTCTTTGGCGCGAACCAGCAGCA
GAACAAGGGTGAGGTGCCGTTCATCAACCGCTTCCTCGCCGGCGGCTTTGCCGGCGCCATCGGCATCAGTCTTGCAAATCCGTACGTTGTATTTTTGCTG
CATGTGTTGCATTGTGTGCGACTATGGGGTGTTGTCATGTCGCCGTCCTCGTCGTCATTTTGCTCTTTCTCTTTGATGGTCGCATGAACATCTGATCTGA
TTCTATGGCTACTTTATTGTCTACTTCCAGAGTGGATGTCATTAAAGTGCGCATGCAGGCAGATCGAACCGGTGCGTTGTACCGCGGCGTAGGCGATGCG
ATGACCAAGATCTACCAGCGCGAGGGCTTCCGCGGCTTCTTACGGGTACGCTTTGGCTCCATTGAGAGTATGGAAATTATGGGGATAATAATGCAGCAGC
TGCTCATCCTAACAGCACATCCATTACGTCTCGATAGGGCATGCCACCGAACATTCAGCGCGGCTTCATCGTGAATGCGGCCGAGCTGGGCACGTACGAC
CACAGCAAAGAGTGGCTCATCACGTCAGGGCTCGTGCGCGAAGGCGTGTTTGCGCACACGGGCGCGAGTTTCGTCGCGGGTTTCGCGGGCGCCGCGGCGT
CGAACCCGATTGATGTGATCAAGACGCGGCTCATGAGCCAAGCGACGGACGCCAAGGGCAAGGGCTTGATGTACTCGGGCATGGCGGACTGCGCCCGGCA
GACGTTCCAGGAGGGCGGTGTGCAGGCGTTCTACAAGGGCTTCGTGCCCAACTGGATGCGCAAGGCACCCTGGTGCATCATCTTCTTCGTTACGTACGAG
AAGTACCGCGCCACCTTCCTGCCGCGGGAGTAGCGATAGTATCAAAGCAAACAAATAAATAAACTAGTGTTCATATCGAGAAGAAAAAGTAAACGCACTT
CATGCTTTGTTATTATCATGGGATCATCTTGCAAAGCAATAGAGAAGAAGAAACGCAGTCATTTTTCCAATGCAAATACTTAAATATTGGTAGTACACGG
GGTGACTTCTAGTAATAAAGCGGGCGAATGACAACATGCTATCATAAACTCTGGCAATGCTTCCTTTCTTTTTTCTTTTTCTTCTTGGGCGTTCCCAAAT
GACGGCCACAAGATGAAAAGAAAGGAGAACACCCACCATACTCTTATGCACAGATGACGATGGCGACTACACGATGACGGGCTTCCTTCATATGGACACT
GGACGCAGTTCGGTCTTGGCGTTCGTTAGCTGGTGAGCGCCTCAAAGTCGCGCATCTGTATGGTCCACGTGGATCGCGGCGGCGTCAAGCTCGCATGGTC
CTTGTCCTTCGGCTCGTTCTTGAGCTTGGCCTCCATTTGTTCACTCAGGTCAATGTACTCGGCCGTGTGCGTCACGTTGAGCTTGGGGTTGTCGGCAGGC
GATGAGACCTTGCCGTCCTTCGGGAGCAGCACGAGCGGCAGCCGCTCGACTTCCTCCTTTGCCCATCGGTCACGCGAGACTGCGTGCACGCTATACCGGG
AAAACGAGGACGAGAACGAGCCGTTCATCATGCGGTTCGTGATTGTGCTCTCCACCGACGGCGCTTCGTCTTCGTCATCGTCATCGTCTTCCGCGGTCGG
GCACCGGCTTGGATCATTCGTCGCCGCATTCTCGCCCGCCGTCGAGCTCTTGGTGAACAGCAAGTGGCGGAAATGTTCGCGCTCGCGCCGCCGCGATTCG
AGAATCTCTTCTTGCGACGCACGTCGTGTCTGCTGCTGCGAGTTCAACGGCGGCGTAGTGCTAGTGGTCATCGCATTCGCCGCAGCCGCAGCAGCGGGCG
CCACTTGGCTCAGACGCCGGCCTTCCATGTTCATCAGGAGTTTTTGGAGTGCGAGGAACGTCTCGTCGACCTCTTCGTCGTCCTCCGTGTGGTCGTCCTC
GGGCTTGAGCTCCGGCGGCACTTTCTT