Description :
From Genome Similarity Track
Location :
Scaffold_281:11179- 12335
Sequence
1156 bases(100 bases per row)
CAACGCGTGAGCACCATTGTTCAGCACAAACTCGGCAAGCGGCAGAAAGTCCCTCCACGACGAGAACGACGTCGCGTAACTGCGGAGAACGTCTTCAATA
ACCCGATTTACGCGCTCCGTTTGCCCATCCGTCTCGGGGTGGGCTGCCGTCGCCATGAGAAGGCGCGTTCCAAGCAGCTTGAACAAGTGACTCCAGAAAG
CGGATGTGAAACGAGGATCACGGTCCGACACGATAGATTCCGGTAATCCGTGATGCGGGAATACACAGTCGAGGAACAAGGACGCAGTTTGTTCAGCGGT
AACTTGGGCGGCGACTGCGACAAGATGAACCATCTTGCTGAAACGGTCAACGAAGACCAGGACACCCGTGTCTCTGCTTGTCAGGTGGGAGGCCAAAAAT
GAAGTCCATGCTAACGGATCGCCACGACTCAGTGGAGATGGCCAACGGACGCAGCGGGGCTTGGACAGAGCCCACACGTTTAACACGTTGACAAATTTCA
CACGAGCGCACCCACTTAGGTACCCATTTGTACATATGAGACCAATAGAATCACGCGACAGGGCAGCGAACGTCTTTTTACGACCAAGATGTCCACCAAC
GGGTGCGTCGTGATATTCGTGCAGGATGCGGGCACGAAGGTCGTTGGCAGCGGGGACGACGACCCGCGGAGCATCGAACGTGTCCATAGAGTACGTCAAC
AGATCGTCGTCAAGATGGTACCGCTCGAGATGAGTTCGAGTCGGACGCGTAAGCGCTGCCAGCGTCTTGACGCTGGGAGAACCGAGGTGGTTGATGATGG
CGGAGTAGAAGTGGTCGTCAGCATAGGCCACCACAATTTCTTCAACTCCGGAGCCGCGATGGTGGAATTCATTCTGAGCGCAACACAAACAGCGCAATAT
TTATCAACTTCGTCGTTAGGAGTAGTCTGATTACACAACAAGCGCCTCGGATCATAATCAGGACTTCGCAAAAGGGCATCGCCAAGGATATTGTTCTTGC
TGGGCTTGTAATGCACCACAAAGTTATACTCCGAGAAAAATGACAACCATTGAGCCATACGCTGCGACAAATGTGGGCTTCGCATCGCAGTTCTCAGCGA
TGCGTGGTCGGTGTATACCGCAAAGGTTTCTTCGCCGAGCAAGTACACTCTGAATT