Description :
From Genome Similarity Track
Location :
Scaffold_659:11178- 12309
Sequence
1131 bases(100 bases per row)
CAATAGTGGTGCACGGTTAGTACACCAGTCAATGCCCTTCACACGTTATGGCGATTCCTGATTGCCGGTGAAGCTTTGAGGCTCTAAAATGTCAAATGTA
GGAAATGAGTGTACAGAACTGGAGGAAaTACAAAGGCAAGTCGATCAAACGGATTCGCGATTGGGATATGGGATTGTTCGATTGGCTACTGAAGAACGTA
TGACGTGGAAGAAAaCTGCCCcTCGCTGAGAAAAGCTAAAGCTCTTCTGGAACTGGAATAGCGCAGCTGCATCTGCATCTGCAGTCCGGCCGAGGAAGAC
GAAGTCACAAATCAGCTCCAACATCATCCGCAATGCATATAGCTCGGAATTTCGGCCGTCTTTCTTTTCTTGGTTGGAGACAGTCGATGTAATGCATCCT
CGTGACTGGAAAATCGACTTCTTTTTCTCTCAGCAACGACTTTCCTGGCAGTTGCGCCACCCGCGCCATCTATCCACCGCAATTCATAGTATGAGGCAGT
GTTAATGTCTGGTGGTTCCAGAAAACTTCGATATGCGCGACTTGCAAATGGTCCAAAATATCGGCCAAATTCGTTGGTTGAAACAATTCCACATCTCGGA
GGAAGATCAAACTCGGTCGCTTGAGCTGGCGTAACGAGCAGAAACACATCCGTGCTTACATCCACCGCTTTTGCTCGCTCTTTGATATAACTGTCTTCGT
TTATCTTCTGTTTGGTTTGCAATAGCTTGCATTGAATCACTTCGTTGGATAGGAGTTGTTGACCACCGACCGTCAATTGAACTCGCATGAATAAATTGCC
AGCAGAAGCACTAGCGTCGTTGATCACAATCGTATTCATATCTGATATTTCCACGCCGCCCTCGCGATTCGTAAAGCACGTTGAATCATCGAGATTGGGG
TCTGTCACTTCTTGATGAATTGCTTCCACGACGGTGCAAGAACTGGGTTCGGTAATCAGGATGTCATCGATTGCACCAAAACGATAGTGAAACCGGAGTC
TTGCAGTAGGCGACAGATTTGTAGAACGCCACGAACTGTTCAAATCGCTTCCACACGAAGAATGAACGCGTGAGGTGCTTGTCGAACTTGTCTACTTCAC
TCAGCTTCATCGGGAGTTTCCGCATCAACGT