Description :
From Genome Similarity Track
Location :
Scaffold_20:111776- 113204
Transcript NameFunction/comments
Phyke_g1277myosin-like protein

Sequence
1428 bases(100 bases per row)
ACGTTGGATGATGACAGCGTTGTGGTTGCTCTTCACGTCGACAGCCAACTTACGCCCCTGAATACCTCGCCACTGGGCTTGCGCCAAAACGAGACCTTTG
TGGAATGTGTTGTATCTCCGCATGGCAATCACGCACCGAATCACGGATTGCAACTTGATgatcgcctccagctgccgCAAGTATCTGATACGCTGAGTGA
AGCCCACCATGATGTTCTGCAGGTACGAGGCCTTGGCGTCGAGGAACTTCTTACGGCGGTCCTCTAGCTCCTCGAGTACTCCCAACTGAAAGTACACACG
AGTCTTACCCATTTGATATTGGGTAGGCGTctcaagcttcagcttgtcCATGAGAAGCTGACACTTGTCCGCCGCCGTCTCACCTCCACTTGGCACAAAC
AGCCAGAACTTGTCCAAAATATCTGTGTGCTGTAGGCGGTTTGGATAAGCCGCACGTGAAATACGAATGGCCTCAATTACACCAGCGCAACGTAGTTGGG
ACACCACCATTTCCTGGTCCATGGCTGTCGAGCTCTTGATCGGGTTGGGTTTGATGCAACGCACGTAGTGCACCTTGGTTgcgttgatggtggccatcAG
CTCTGTTAAGCTCTCCTTAAACTGTGTTCCAACAGTTCTGATGGACAAAGCGCCACCGCGCTTTCGGCGACCACCCGACGCCTCCGATGCAGCTGCCTTA
GGCTCCGGCTTCGGTTCAAAGAGCTTAGCGATGAATGGTGTAGACGAGCTACGCATGAGCTCCGACAGGTCGGGCAGCAATGAGTCCTTGTGCTTCTCCA
GGAAACCAACCGAATCGTACATGACAGGTGCAGCGTAGTGTTTAATAAGGAATTCCGTGCGAGACGTACGGGGAAATTCAATGACGTGAGCCATGTCATC
CTTGTGTAGTGAAGTCACCTTCGACATGAACGATTCTTCATTGCCTTTTGGCCGCATCACCTCTTCATTAAGCAGTGAGATGATACCCATGCGTGACTCA
ATCACGCTCAACACATCCTGGTTATCTGCGTACTCGATGTGGTCCCATAcgatgccttcttcttcatatTCGATCTGCACCGTCTTGAACACATCCTGTG
TGAACTTCTGCTGAAGTTTCTCATTGGCGTAGTTGATACAGAATTGCTCGAACGAGTTGTGTTTGAAGTGCTCGAAACCGAAGATATCCAACACACCCAC
GTGATTCGCCATGTTGGCATCATCAGCAAGCGACTGGTTAATCGCAGTCACAAGCCAGTCGAATACGTTTGAATAGATAGCCTTGGCGAGTGCGTCACGA
CAGTCCATGGCCAACTCCTTTTTCAGTGGCACACTGTACACATCGTTGACAGCACGCATGGTACGAGAACACAGCGcagtctgcagcgcctccCAAGTTA
CACCAAGCATTTGGGTTGCAGCTTGTGC