Description :
From Genome Similarity Track
Location :
scaffold_14:111712- 112739
Transcript NameFunction/comments
Plaha_PHALS_08172hypothetical protein

Sequence
1027 bases(100 bases per row)
AGCTTAAGGTATTTGACACGACGCTCGATCTGGTCCGGCGTTCGGTCGCGCTCCTGAAACATATCTTCGTACGNNNNNNNNNNtgcgacgtttgtgctca
tcgagcctaggatatataCCTCGGTGCTgcgacgcactgtccgacgttgcaccgagtgcgagagatgaagttgggctctgtccATGGtcgccgtcagaac
cggcgagacttggaggtTTTGatttcattgacacagggctcattgagcaaggaagttgtttgttccaacaaatggagttgcagtgtctaacggacacacg
agcctcgttgaggttaTAATTGATTGAAACTGCaaatgttttcaatcttaatgggggagggtgtaacagggttacacgaaccctaataaaaggggtgtgt
gcgtgtcgcacgagatgtgcataatgtgaccacacacccaaaccaagaatacgggacggggctaggtagccagtagttatggatgtattttgattttacg
atatatatttagtatatttaggaaaatctaaattttAACATTGGgataaaaatttaaataaaaatcagtttcggtttgccttggtaaggcttttaagaac
ttttagaggcagcggattgcgatccgctgcaccagtacttggttcttataAAAAAGGTccgtgacctaaagacgcttcctcaagcgcgaagctacggcag
ccccgctgcatagaaagtatccagtagaattgactggcttacgccacccacttttAAAGACAGAGGCACgttggtctcgtcaccagtacagatcaCCAGG
AAGGACCCAGCATCCTGTAGCACCCAGAacttttgtgacttcatataagaagATTATGACACAAAGCATTTGGTACAGTATGCAATTTTTTCGAAaatat
ttgattttgaatattTGTTTGGCTTGAAACCTCAGCAATTGAAAATTTGAATTGACCGAGGTAGTGTTAGCAAAGGCTGTAGGTAGCCCCCGCCGGCAAA
ATTCTGATAGACTAGAAGTATCTCTAC