Description :
From Genome Similarity Track
Location :
scaffold_65:111708- 112818
Transcript NameFunction/comments
g1632.t1hypothetical protein

Sequence
1110 bases(100 bases per row)
GGACCTACTAATGTCTGCAGGGGACGCCAATGCAACGGTAAAACTCTGGAAGCTGCCGACTGATGGACCAATGGCGGAGGACCTCGTGGCCCCTCTGACC
GTCTTCCAGCAAGAAACACCGGGACTTGTGGCGGGCATCGTGCCGCATCCGTCGGCTGACTCTGTTGTGGCCACGTACTCGAGGCCGGGGGCGGTCAGGG
TGTATGATTTGCAGGCGGAACAGCTGAGCTTCCAGGTGCAGGTGGGGGGTCAGGTTGCAGTGAGTTCTGCGGTCTGGAACTGGGACGGCAGCGCGATACT
GGTGGCCACGCAGGACCAAGCGGTGAGGCTCTTGGACCCGAGAGTGAGCGAGCAAGTGTCGGCGCCGGGCATTGACGCTGCACATTCGGGCAAGAGACAC
TCGAGTGTGGCCTGGTGTGGACGCACGAACCACTTTGCGACGTGCGGAAGCAACCGAATGCAGGAACGGGAGTTGAAGTTGTGGGACCCGCGACAAATGT
CCAAGTGCGTGCATCGAGAGAGGCTGGATGCGGGAGGAGTGGGCCAGTTGTTCCCGTTGTACGATGCGGACTTGGACTTGTTGTACGTGCTGGGCAAGGG
GGATCGCAGTGCCAGGTTGTTTGAGGTGGACTTGGCGCGGGCTCCGTATGTGCACGCGTTGGATCACAGTGCACTTGGCAGCATGACGCTTGCTGCGGTG
TTGCTGCCAAAGGCGGTGTGTGATACGAATGTGTGTGAAGTTGCGCGGGTTCTGAATCTGAGTGCGACCGGAAGCAGTGTGGGCGGTAGCTGTGAAGTCT
TGAGCTACCGTGTGCCACGCAAAGAGGCGACGCATACGTTCCAGAGCGACTTGTATCCAGCCACATTGGCGCTAGATGCGGCGATAACGTCCGAGGAATG
GCGACAGGGGCGCAATGCCGAGCCAAAGGTGCAGACTGTGACTCCGACGGTCAAAGGTGCCGTGGATATGAGCGGGAGTGTGTTTGGCCTGCACGCGACG
AACGCGTCTGCGGCGTCTCCCTGGGGTGCAGCGGTCTCTGAAGGCGGTGCCGCCACAAATGGATGGCAGACTTCAGGATGGGAGCAAGCACTTTCGTCAA
CTGCATCATC