Description :
From Genome Similarity Track
Location :
Scaffold_80:1117- 4476
Transcript NameFunction/comments
g8347.t1POM63496.1 Serine/threonine protein Kinase [Phytophthora palmivora var. palmivora
g8348.t1OWZ14773.1 actin [Phytophthora megakarya

Sequence
3359 bases(100 bases per row)
AGGTGAAACAAAGCCTTAGGGATCATATCCTTCTTTGGTCATTGAGGACCGGGGGTACATGTACATGGAAACGGTGAGAAAGCGTATTTTTTTAGTTTTG
GCAAAGCCTACCTCTCTTGTACAGTTGTTGGAGCGGGTATGTCTGCAGATTATAAGCCTACAGGAACAGCATCCAGCGCCAGCACCATCCCCGCCGATCA
AGTGACGTCGGTCCAAGTGTACATCTACACCAATACAAGCAGCGCGCTCGTATATAAAAAACAAAAATGCGAGTCGCATGGGAGAGCGGAGCGGAGCAGC
ACTCGCCAATCCTCAGCGCACTAGTGTTCTAAATTTTCTCATTAAGATTTCGAGCTGTAGCCAACAACTCGAAACAGCGCGCAGTTGAGTTGGATGGTTG
GTTGCCCTGCAATCGCTTTCAGTGTGAGATTATCGTCAACTTTCTGCTCGGTGAGACCGCGAAAAGATCGGGTGTGATGGCAGCGCGCTGGCCACCATTG
CATTTTCTGCGAAAAATGAAAAAGAAGTGTTGATGTCCATCACGATCAGACGTCTGGGAGCACCGCGCTGCCAGAAAATACCGTCCAGCTGCGAGCGGCA
GATCGGGAAGCTCATGGCGATCTTGTTCTTTGTGTTTGGTGATTTAGAGGAGTTCGCTCCTGAGATATCGACGCGGCACACTGGGACTTCCAGTGGGACC
ACGCTCGATGAGCTGGCGCGTGTAGCTAACGTACCTGTTCTTGATGCGTACTCGTATGAGAGCAATGCTCGATTCAAAGGTATGCCTCGTGCGTTGAAGA
CAGACGACCTACCCTAACATCCCCGAAACCAAGGTAACATATCAAGACTAGTCGTTACCTAGACAAGAGTCTCTCGTGACGTCCACTGTTGTCCATCTGG
TTGGAAATGCAAATTCAAAGGTGTCCTTATTAACATATTACAAGCTAGGTGTTGTCCTTGCATGTATCTCTGTTCAAAAAGCATTTGTGTTACCGGACAT
ATATCGCGGATTATCTGTTGTCGAATCACACTCTATACAAAGTTTGAGTCAAAGTTTTTGCTCTAGGACAACATCTGGGAACGTCCAGCGAACTTAAGCG
GATGTTTGTCCATGAATCAAGGACAATAAATGTTGTGGTGTCGTCCTTGGAGGAGACTTGACCTCACCTCAAACACACCACAAACTATCCTCAAAGGCTT
TTTGCTTGGCGATGCTACACTCATCGGGTGTCATCACCAAGATTTCTGTCCATAAATTTCGCGCAGGCATAGGTCACTTCTCAACTTCCCGTGCGGTGGT
TAATTCGACTATTTAGCAGTCTTGCCCATGACGCTCGTCCACAACCGCTACCGCGTGGAGCGCGAGCTGGCACAGACGACGTACGGGGGGATTTACCTGT
GCACCGACGAGCTCCAGCGGCCGAGACGCGTCGTGCTCAAGCGCGTGTCGCTCCTGCAGGCCATCAACCTGCTGGACATGCGCAGGTCGCAGCTCCAGAC
GCCCGACGACCCGCGGCAGGAAAAGGCCTTCGCCCACTTGCAGCGCGCCGAGCGGACGCCGCACCCGCACATTGTGCAGTACCTGGACGACTTCATGGAG
GGCCACACGCTCTACTTCGTGCTCGAGTTCTGCGCCGGCGACGACCTGTACAAGGCCGTGAACCGCGGCGAGAACCGTCGACTCAAGTGCGCCGACGCGC
TGGACGTCACCAAGCAGGTGTCCACGGCCGTGAGCTACTTGCACCGCAGGAGCATCGCCCACCGAGACGTGAGCCTCGAGAACATTTTGCTCAGTCGGGG
CGTGTACAAGCTCGCAGACTTTGGGCTGGCCACGAGGGCCGACCGCCTGTGCATCGAGTGCGCGGGCAAGGCCTACTACATGGCGCCGGAGGTGGTGGCC
TCTGGGGTGGCGTACGACCCCAAGGCGGCCGACGTCTGGTCGCTGGGCGTCGTCCTGTTCATCCTCTTGACGGGTTCCCCAATCGTGCAGCTGGCGACGG
AGGAAGATGCGCGCTTCCTCGCCTTCAAGAAGGTGGGCGTGCGCGAGCTGCTGCGCGTGTGGCGCATGACGCACTTGGTGCACGAGGGCGCCATGCGGTT
GCTGGAGGGAATGCTGCAGTGCGACCCGGCCAAGCGACTCACGATCGAGCAGGTGCTGCAGCACGAGGCCTTCGCATGGACAGCCGCCGCGGCGTGAAGC
AGAGAAGGAAGGCGGGCGAGCAGACAGCTACATGTAGCAGGCTAGTGTATATAAAGCGTGAATTGAATCCCAGTGTTAGAGAAGGCAGAGGAGGCGCGAT
CTTTGAAGCTGCAGTCCTCTGACTCAGAATCTGCCGACTCTACAGACAGGGCGTGGCGATGCTCATCTGAACTTTGGTGTCCACCTGCACTTGAGCTGCT
GCAGTGGACGTACGCCGGATTCCGCCCGCGAGCGACGACCACCTTCGCCAACCTTAACACTCGGTGCAGGGCAAGGCTGGAAACGGGACATCCACGGGTG
GTGATTGCCATCGCAGTTGACACTGGACGTCACAGTGGACACGCACATGAGCCTGTCCTGGGGTTTCATGAGGGACACATGCAGGTACATCGGATCCCGC
CGGTCAAGCATGCGTCGGACCGGGCAAGAAGTTGCAAGCCCTCAAACTACTGTGGACATCGAAAGGCTCTGTCGCCGGTAGGTATTCGGTGCGTGGAGCT
ATTAGCGAGGGATGCCCGTTGGCAAAGTACCTACTCTGCTGCCCTCGCGCTTCTTTTGCCACGACATCACCGAGAACTTGGGGCTTTTGGGCACCGTCAG
CTTCTTGGCCGGCTGTCGTTTACCTGACGAGTCACCTCCAGGAAGCTGCGACGTCGAGCGTTGGTGCTTCAAGTGAGACCCTGAAGTCGCTGCGCTTTCC
TCCCGTGAGTCCGACGAGTTCTGCTGTCCGTTGCGGCTCATGGTCGCTAGCATACTGTTCGCGGACTCTGCTAGCGATTGTCCAGTGTTCGACCTCTATA
CGCTGCGAGCTGTACGACGTGCGACAGAGTTCAGGACATGTATTTACTACTCCCTGAAGCTATCCTATTCGCAAGAGCTCGGGCGCGATAACTAAGCGCG
AGATCCGTTAGACACTCACGGACACTTCTTGTGAATGAGCGCGGCGCCATGCTCTGCGTACTCGGCCTTGGACATCCACATCTCGTGAAAGGATCCTAGT
GACGCCAGAATGGATCCACCCAGGAACGAACCAACGCGGCGCTCCTGCGCATGAGCCGCTACCACCTTAACGCGCAAACTGCTCGAGAATCCGCCAGCCG
CTCCCGAGTTGCCTGATGCTATGAGGGGCAATGGCGTGCCGCTCAACGTGGTCACCACT