Description :
From Genome Similarity Track
Location :
contig_187:11169- 16222
Transcript NameFunction/comments
g14661.t1hypothetical protein
g14662.t1hypothetical protein

Sequence
5053 bases(100 bases per row)
TGAAGGAGTTCAAGCGAACCAAGATAGGGAAGGAACTGGAAGGACGGATCGTGCTGTTTGAAGCGCTGGCATCGAAGTTGGATGAAATAGCAGTCGAGCA
CGGTGTCAATCTCGGCATCTCCTGGAGCAAGCACTCGTGGTCGATGCAGCCAGACCTATCGTACCCAGACGTGTCGACTCATGCGTTCCGCTATGTGAAA
TCGCAGCGCAAAGGCATAAGGGGCTGCTCAAGAGGCAAATCGAGGAAGCGGTCGAGAAGCTGCGTCCGATGCAACCCGAAATTGACACGTTCGTACGGGA
TTTCAAGACCCGTGCCGCTCGTCTGAGCGACAGCTCAACACGCAGCTCCGTGACCTTCGCTGACGAAGAGGAGAAGGATGCTTTGGAAGACCATGGACTT
GAAACGACTGCTGAAGACGAAGATATTGCTAGCACTGAGGCAACACCTTCGGTGGGGACGACTGACTGCGTCAGTTCAACATCGCGGAAGCGCAAACAAG
CACATAAGGTAGCAGAGCTACCCGACACCTTCGGTGTCTATCCCCCAGCACATCGTTCAAAGCGCACGAAGGCTCCCGCGACGACAACACCTCCCGCAAC
GACACACCTCCCGCGACGACACCTCCCGCAACGACAACGCCTTCCGCAACGACGACACCTCCCGCGACGACACCTCCCGCGATGACACCTCCCGCGACGG
TCGAAAGCCTACAGTTCCACTTTCCGTGGCCGATGCACTGGCGAAGATCAAAAAAGAATTCCCCCAGTACGTTAAGATGACTGCGGAGGAGTTGGTGAAT
TTTCAGAATCTGCTGGTTAATGGACAGCGTGCACCATCGGAGGAGGAGCTGCAGACGTTCAAGGCGGAGGCCGTCACGAACAGAAAGAAGGGCAAGTTCG
TCAACGTTACGAAGGACGTCTTCATGCGCATGGTGTCACTGGTATTCAGCACTAATCTACTGATCGAAATCATCGCGGACATTTCAGGAGTGGAGGTGAA
GACCGTTCAAACTTACACTGGACGCCTGCGAGTGATACTGAAGCGGGTGAACTAGCGCGTGAAGTTGAAGCTGCTAGTGTAGCAGGTAGCTGAATTAAGG
GGCATGCTCTAGTCTATCTCTAAGTCTCAACAAGAAAGTCATAACCTGCGCGTGGTGTGTCGGATATATGTCTCTCAGTGAGCGAATGCGGAAGAGCGGC
GAGGCTCTATTTGTCGGCATCGTCGCAACTACGTCCACCGACAGCGAGTGCTCCACAGCCAGCCAATCCAGTCTCGCCAGCGACGCGTCTTTCTACAGCG
CGGTCGGTGACGAGAGTGGGCTGGTCGGTGGCGCAGTGGACGGGTGGGCGGATCCACTAGGGGTGCGGTTACACACTGTGGATCCGCTCGCCCCCGTTTT
GGCCCTTTCCGGACCGGAAATGGGGCCCGAAGAGCCTCCACGTGCGGTGCCGCTGCTCGGCACCGGCGACGCTTCAGCGGCTGCAACTTCGGGCACGGGT
CCGGGACCCGCAGCGCCCATTGCACCGCGACCCCTCACGCGCCTCGAGGCCGCTGCCGGCCAAGAGACGCCCCGCCCCGCCTCCACGACCTCGCGTCGTT
TCGGGGATCCACCGGCGGATCCACCGTCCGCTGGCGACAGTGGACGGTCCGCTGGTGCGGGCGGGAGGTCGGCGCACCCCTCCCCACTCGGCCCCACTAT
CGGCCGAATGCTGGCCTCTCAGGCCGTACGTGTAGCGGGGCTACACGTTCGGTTCACCTCCCACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTG
ACCACCACAGGGTGGTCCACATTCATAGCAAAAAGGCATATGACTGGTAGAAAGTAATACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTG
CCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGT
TTGGTTCTTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACCGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTA
AGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGG
CTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGA
GTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTG
GGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCT
ACGTTGGAAGAGAGGGCGAACCTCTCCTCCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCAT
GTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGC
GTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTAC
TTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCC
GAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGAT
GCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTG
CGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACG
GGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCC
CCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAG
TGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAACACCTCGAAGTCTATTGGAAGTGAGGCTA
GCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGA
CGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGC
AGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTC
ACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGT
CCGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGG
GAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGA
TCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGA
GCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACAC
AGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGATAATCCTCCGACGTTAGCG
TCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGA
GGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTG
GGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTT
CAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAA
GTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGC
GTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACT
CTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCC