Description :
From Genome Similarity Track
Location :
Scaffold_99:111688- 117454
Transcript NameFunction/comments
Hyaar_Emoy2809339pectin methylesterase

Sequence
5766 bases(100 bases per row)
GAGCGGGATGGTCTTCTTGTGTCGGCTACGTGTCGACGAATGTGATCCACAGTTTGTATAGCATTCGTAAAATGTGTATCTCTATCGCTACAAGGAGTGT
TGAGCGGTTGGTGTGAAAGTGGCTAAAAGACCTCTTGACTAATCTGCTTTCCATGGCACGCTAGCAAGAATACGCTTATGCTGACCCAAGATGTGCTCGA
CCTGGCTTGGATGCTTATAGTTGCTCGTGCTCTGAGATTTGCTCGCACTGGCTCGGGCGCTGGCGGTTGTAGGAGTACAACAGTGTCCTTGACACTGGCC
TCGATCTTGCTGTAAACTGTGCAAGCTTCCGACTCCATGTAGATGTCAGAGCATGGCGTGTCTGCAGAATTGACCGAATCACTCTTATGCGGCGCTCGGC
AATTACGTTGCAAATTTACCGCTGGAACGCATGAAAGAGTGTTTCTTGCCTTGTGGTTATGTGTCTTTCAGTGGTGAGCGTTATCCGTTTTAAACGTGAC
GGGATGAGGATGCCGTTCGTATACGTCGTCTTTCCACTCGGACGGTCTTGACCAAAACTCGCTGATATCACGGGAGAATGCTGAGTTTTTATCGCTGTCG
CTTTCGTTGGAAGATACGTTATTGTCCGTTGTGCCCACAGCAGCATTGAATGTATGAGGACCGGAACCACTTGGTACGTTTGCAAAGTAGTCCAGACTGC
CCCACGTCCTCCAGCTTGCCAGAACGTCAATTTCGGTGGGAGATGAAGGACCTATAGCTTCCAGCATGGGCATATCATCAAGTATTATATCTTTGGTCTT
TCCTCCCACCATAATGTCGAGCATGGCTGTCTGCTTGTGTCGTGCTTTGTTGCGTCTTGCGGGTATAACTGGCGCGACGGTCACTTGATGTGCGCGTGCA
TCGACGATGGGGATAGACACAAAGTAAGGCAAGGCAAGCGCGTTCTCAAGTGCCGCCCACCACGTCTCGAAGATAGCGCTGGTCGGCGCACGTAATGTCA
CGCTCTGGTGCCACGTTCCGTAGCGGATTCGGAGCTGATGCCGGCGTGCCTCTTTTCCTGATATCGAAGTGAGACTGCTTACGTTGTGCTGGAGATATAT
CTCAAGTTTGCCGCCAAAGGCCATGGGGCGAACGATAGTCAGCAGACCTGGTCTTTGCCTGGCAATAATCTTGAGCGAAACGATGACCTTGTGCCTATGA
CCATGCAACAAAAAGCAGCAGGGAATGCGTAGCTAAGCATTGTCAGTGGGATACTGTGGCGTAACCAATTTCAGCAACTCAGACTCACCAGAAAAGCCTA
CAAATCCGCATCTTCATGGTACAGCGAAGAGTTTGTCGAGTATCCATTGAGACGTCGAGCCGTGGTTGTTCCGATTGCGGTTATTCCTAGTGATCTGGGT
CAAACAATGTGCAAATGAGCAATGGAAGGAGTTGAATGAAGGTCAGATCCTGGAACCCGTTGTGGTGATCACACTGTATTACAGTCAATGTAATTGGCAT
GCAGTTAGTGAACACTTGCTGGCTATGGCAACGGACAACGACTAATATCGGGACGGATTACAGTTCAACTGCAAATTGTGCACAAACTAATGTACAGTCT
TTCGCCGACCAGCATGTAGCACCGTGGAAAGGTGCTGCTGGTGTTTTTGCCGGATCTAGCCAAACTTGACCGTCTCTTTTCGTCTCCACTTAATAAATAG
GGCAACATGATACGTGGTAGCTGGCGAACAGGCTACTGTTACACATACGTGTATTGAAACCGTGAAGCCTCGTGCACTTGCTGCTGTGATGAGACGGTGG
AGTCTTTCTCCAGAAAGTGTGACCAAGAGTTGGGCACGTTGAACTTTTCGCACGGTCTTATTCCAGCAGACCGATGCAGTTTGGTTTGCTTTGTCCGGCG
CAGATCGAGTCGAGGCCAATAGATTTGAAATTTTAACTGCATGATGTACTTGCAGGTACAGTTGTTGCAGTGCTTACATCAGCGGAGAGGAATATAAACA
CTCACAAATACATTCACTTTAATTATCTGCGCAATGTCGTTCCTGATAACCCAAACGAAAAATCGTCAAAGGCTGGATATGACCTACGGTGGCATAAAAA
CGGCCGATACATGCAGCGTGTACAGTAGCATAGCATAGCAGCAAAAGTACGCGTCCATAATTCGTATATGAACGTGAGTACCATACGGACTTGTAAGGGT
TCAATCTTGTGCACCAAAAGAACAGAACACCTTGACTGGGGCAAATTTTTACGCCATTTTACAGTTGGGTCATCATTATCACGGCAAGTCAATTGCGGTG
TTTGCAAGTCCAGCATACGCAATTGAAGTGGCGGTTTACCTTGTAGAGAAAGGTTTTGGCAGTATGGACACCGATGCCAAACACGATAACGTATAATCAA
GCCATCTATGGGTGCATACGTTTATCAGGGTTATGAGGCTCCTTCGGTCGGAGCAAAAGCCGACAATGAAAAAAACGGTAGCACTCGTCCTGACTTTGTC
ATTATCTGCGCCACATGCTACAGGACCACATTATCCAGCGCCTCGAGACAGATTTGGTTCTTGAATGTTGCTGGTCATCGGCCGCCCATTCATAGTGCTG
ACAAGGGCAGCTTCAATGATGTGTACATGTACGTGACCCCGAACCACATTATCACAGCATCATTATATATCTCAGCAGAGATCAAGACTTCGGGCGGGTC
TCACATCACATTACTGGGATCCACTTTTGGTATGCGTGTGAAATCAGTACTATGTTCATAGCTAGATTCACCCTCAAACAATATTTAGCGTCCTACATTG
CTCAAACTTCGTCCCCTACTTTTTGCAAAACATGCAATGCATAAAACTGGCTCTTTAAGACATGTAGTATGTTTCATTTGTCAAGACTTCCAAAAAATGT
TGACGGACTTTATGCTAGATATTCACTGCATCGTTCGTAGTCACTATCTTCAGATAGATCTTAGTACTCGACGTAAACAACCAGATATGCTTACAATCGA
ATAAATGATATGGCACTTGAACCTTCGCCTCGGCTGGAACTACTTATCCTAGATAGGTAGACGAAAGAAGTATGCGAAGGCGGTTTTAGGGGGCGTACAG
AGTATGGTGACACAAATGGTAGAGCTTTGACTTTTTATCTGCTACTGTGGGCAAGAAAAACGTCTGTACACTCGAATGAAGAAAGCTTATCTGAATCGTT
GATCGGTTAACAAAATATCAAATTACCCTTACCTAACCTTGATTTTTCCTGATCGACAAAACTATGTCGATCCATAAGTGTTGTCGTCTGAGTACAAGAA
GTGATGTACACAACTAAGAACAGGTCCCATGCGATGTTGACCATCATGGGGTTATGCGCGAGAAATTAAGACAAAATTGAGGGTAAAGAAGGACAACAAG
TACTTCATTCATGCTATCGTTCACGCTAAAAGCAGTACGTTGTCGGTTGAACGCATTGTAAGGATCAAGACATCACGCAAATCTTTTAATATCCTTGCAG
CAAAATTGATGTGCGTCACCAGCAGTTATTCATACCGGTGCTCCTGATTTCCAGCTTGCACAAGTGACCGCTGGAATAGATCTGCACAGACTATAGTGCC
AAGAAGTCGGGATGGTGAAAAACTATACAAAGTGAGGCAATGACAGGAAAGAAATGAAACGAAGAGCGATGAGGAGGTAGAAGTCGAAGTTGTACGGACA
CTGCAGCCAGAATGACATGCAACAAAAGTTCGTGAGACACTGCGCACAGATGACAACAATGATGCGCGCATTGGGTAGTACTGGTGCCTTTTGCTATATT
GCCTAATATAGTTCAGACAGCGTACGATTTTACGGGAGATAGCGCCTGGCAAAGTCATTCAGAACCCATCGACGCAAAAAACACATTTGACTCTTCCCAA
ACAAGTACGAAGCAAACGAGTCACTCCATCGAGATGCATATTGGTAGTACTTTCAAGCAATAATCTTGCCGTAAGTCGAACCATGACCCATCGTGTTGAA
GGGCGACATAACGCAAGACAAGCTCGATGCCTACGTTGAGTATAGGACACGAGAACAGACCAATATCGTGGTATACAATGGCATGTAAAAAGCTCAGTAG
ATGCAGCAAAGTGTTGAAAGTACTGCGAGCAGTATCCAATTGTTTCGTGAAGCAAAACTCGTACATCTATGCGAACGCACTCAAGCTGTGATTTTGGTGC
TTTGGGCACCCAACAGCAACATCTAGTACAAGTAGGCGGTGTCAACCCACCACTGCGTCGCGTAGTCATCACCGAGAATCTCCGTGATCGCGATCAGCGC
ATCCAATTGTCCGCTGAACGCCACTCTCTTGTCAGTGGCAGCACCGGGACCCGAGTTGTTGAACTCCTTGAACACAACGTTCGTCGTGCTGGCAGTATCG
TTCCAAGTCGACCAGCCGTTCGGCGCAATAACATCGCCGAGCTCGCTGTTCTGCCAAATCGTACGGGCATACGGGAACCACGGGCGCCCTAGAGTACTCG
AGGCGACGCCGCTGTTTCCGAACACGCGGGCACGATTAAAGACGAATGAAGACGGGTTGGCCTTGGAATCACGGCCATTGGCAGCAATATAACCTTTGCC
AATGATCTCGATGTCGCACGATTCAAACCACGCCTGTGCGTAGCGACCAAAGACAAAGTCAACTGCTCCATTAATGTACGTGTGGGCGTAAAGTTCGCGA
CCCTTGTCGGCCAGCACCGTATCCTGGTAACCTGTGAGGTTGCAAGCGTAGAATCCATAGTCGGTTGCATTGACGTTCACAGCCAGTGCCTGGCCGACGT
TGCCGGCCGTATTGGCAACGTTGAGGTTGTACACCTTCACCTTGTTCGACCTGAACCGAATCGTGCTTGTCAAGTCGTTTCTGGCTTCACCTTTCACTTC
CTTGGGAATGTCCTTCTGTGCCTTGGCCTGGGTGATCGTCACCTCGTTGCACGCGTAAGACATGGCATCACACGTGTAGCCTTGCAGCACCAATGGCCCT
GACAGTGGCGAGACCAGAACCTGCTCATTGTACACGCCTGGACGCACGAAAATGGTTTGCACCGACTCGGTGTGAGGATCCAACAGTGCTACACCCTCCG
ACACGGTCTTGACACTGTTCTTGTACGAGCCTGTGACATCAACAACAATAGCCCCCATTGGAGGCTCAGTACGTGCATTCGGTCCATCGCACGTCCCTTT
GGCAAAAGCTCCAGCCAGACTAGCAGCTACTCCGACTGTAGTGAAAAGTTTCATCGCTTTGAGGTATACAACGAGGATTGATGAATGAGCTGTCCAAAGA
GACTGACCATACTGGCAAACCATAAGGAGGAGTCAGTGTGGACGATGGTCATCAGCCCCGTCGCGAATGCATAATGAATGCTACACTTCTTCTTAAGCTG
GGCAGTGTGTTGCTAACAAGACAACAGTGCGCATGTCAAAAGCGGCTGTTTTTTCTTCTGTTCTATTCACACATACAGCCCATGGTGTATAGGCAGCAAC
TAAGTATCGTTTTGGACACGATCAGTTGTAAACCGACGAGCAGCAGGTTATGGACAATCCTTCAGGCATCCAACTGCTGATCGTGCTCCAACACCTTTTC
ATAGACTACGGAGATTTTGCTGCTTCAATTGTCGACGAGCGGCTGTGCCGTTTCTTGGGTGGTGATGGCGTACGACGACGAACCGTTTCAATTGATAAGA
CACATCCAACAAAAAGCACTCGCGAGTCTCTCCACATAGTATCGCGATCGACGATTGGGGCAAAGT