Description :
From Genome Similarity Track
Location :
Scaffold_347:11166- 23279
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_347-fgenesh-gene-0.5Cullin family protein
Pytul_var.sporangiiferummaker-pug3_contig_347-snap-gene-0.18U3 snoRNP-associated protein Utp7
Pytul_var.sporangiiferummaker-pug3_contig_347-snap-gene-0.14Inositol-3,4-bisphosphate 4-phosphatase

Sequence
12113 bases(100 bases per row)
GAGGGAACCAGAGAAGCAGGGAGGAGGACTCAGAAGGCAGGAGCCATGAGCAAGCCCATGATCGGGCTCGAGGACGGCTGGGACCACGAGATCAAGCCCA
AGGCCATCGATGTGCTGCTCGACATCCTCGACCGCGGCTTCGACCAGGTCAAGGTGTCGCCCTTCCCGCCCAACTCGTTCATGCCGATCTACACGACGTG
CTACAACATGTGCACGCAGCGCTCGCCGTACAACTTTTCCGAGCAGCTCTACGAGCGCCACGGCAGCACGTTCGACACGTACCTCGAGAACAACGTGCTC
CCGAGCCTCGAGCGCGCCCATGATGAGTTTTTCCTGCAGGAGTTGGTCAAACGCTGGCAAAACCACAAGCTCATGAACAAGTGGATGACGCGCTTCTTCA
TGTACCTGGACCGATACTACGTCAAGCACCACTCGCTGCCAACGCTTGACGAGGCCGGTCTGCAGAGCTTTGACCGCGTCGTGTTCCAGAAGGTGAAAGG
CCGTGTGAAATTCGCGATGCTCGACTTGATCGAGAAGGAGCGCAACGGCGAGATCATCGACACGACGCTCATGCGCAACTGCGTCGAGATCTTTGAAGTC
ATGGGCATGAAGTCGCTCGATGTGTACCAGACGCACTTGGAGGCCGAGCTCGTGGTCGCCAGTGCGACGTACTATGAACGCAAGTCCAAGGCGTGGCTGA
GCGAAGATTCGACGCCCGTGTATTTGCAAAAGGTGGAAGATGCGCTTCAAGGCGAGCGTAGCCGTGTGGCGCGCTACTTGCACAAGACGACGGAGCCAAA
ACTGATCAAGCGCCTTGAGACGGTGCTCTTGGAAGTCGCGCAGAAGGAGCTGATTGAACGTGAGAACTCGGGTGTGATCGCGCTCTTGAAGTACGACAAG
TTGGACGACCTTGCGCGCATGTACCGCCTGTTTTCGCGCATCAAGAACGGTTTAGAGCCGATTGCGGATTTGGTGCAAAAGCACATCACGGCTGTCGGAA
ACGACATTGTTGGCAAACGCGCCAATGCCGTCACCAGTGGCAACATTAAAGATGCCAGCTCGGACCCTGCGTTCATCAAGGACATTCTCACGATCCACGA
CAAATTCCGCAGCATTGTCAACGAGCAATTCGCGGGCAACTCGCTGTTCCAGAAGGCGTTGAAGGAAGCGTTTGTGGAGTTTGTGAACAAGGATGTTGGA
CCTGACAGCTCGGCCAAGCTGATGAGTACGTTCTGCGATCGTATTCTCAAGACTGGTGGCGAAAAACTGAGCGACGAACAGGTCGAAGATTACTTGGAGA
AGATCGTGTTTGTGTTCTCGTACTTGACTGACAAGGATCTGTTTGCTGAGATTTATCGCAACCAACTGGCGAAGCGTCTTTTGAACCAGCGTTCAGCGTC
TGCTGATGCCGAAGTGCTAATGATCGGGAAACTCAAGTTGCGTTGTGGTGCCCAGTTTACGGGTAAGATGGAGGGCATGATGAACGATCTGGCAATTGGA
AGCGACCACCATCAAGAGTTTGAATCGTTCTTGAAGAACCAACGCAACAACGAATCGGGAGTCGCTGCTGGTACTGGTAACATGGAGTTCAGCGTGCAGG
TACTGACGACCGGGTACTGGCCGTCGTACAAGGTGCTCGAAATCACGATGCCACCACAAATGGTACGCTCAATGAACCTGTTCAAGGTCTACTACGACTC
GAAGACCAGTCACCGCCGCTTGCAGTGGATCCATTCGCTCGGTAACGCGACGGTAAGGCGAAAAAAAACATCTTCATGCTGTGTCTTCTGTTGGTTTAAC
TCTTAACATTTTACGCAATGTATGCCTGCTGCTAGATCCGTGCAAACTTCCCGAAGAAGAAGTGGTATGACTTGCAAGTGACGACGCTGCAGGCCGTCGC
GCTGTTGCTATTCAACGACGGCGATGGCGCGCTTTCGTTTGAAGCCGTTCGCGAATCGCTCAACCTGTCGGCCGATGTCGTCAAGAGAATCATGCACTCG
CTATCGTGTGGCAAGTACAAGGTGCTCTCCAAGTTGCCAGCGGGTAAGACGATCTCGACGAGCGACAACTTCGAGGTGAACAAGGCATTTGTGTCGCCGA
TGCGCAAGATTCGCATTCCAATGGCGTCGCTTGAAGAGAGTCACAGTCAGAAGAATGTGGAGGAGGATCGGTCTATAGCCATTGAAGCCGCGATTGTGCG
TATCATGAAGGCACGAAAGACGTTGCAGCACCAGCAGTTGATCTCGGAAGTGCTGAGCCAGCTGGCGTTCTTTAAGCCGAACTTGAAGGTGATCAAGCGT
CGTATCGAAGCGCTCATTGACCGAGAATACCTGGAGCGCGACCCAGATCAGGCGAACACGTACCGCTACCTCGCGTAATTAGACGTGTTGAAAACAGAGA
GTAGGTCCTTTGCATTGGGGGTTTCATTCGGACTGGCGACTTTAGTTTTCTTTCGCTACTTACTGGAAGAAGAAAAACGAGCAGCAATCACCGCCAAAAA
GCTATAAAATGGATTGACGTTGATTTTTTTCTCTCAATGTCGTGCTGTTTTTCTTGGTGTCTCTATCTAAAAAGGATTTGCGCTAATACATGCAAGTAGT
AGGATACGATACGATTGACCAGCGCAACTACGGTTGCTTCTTGAAGAACCGGTTGAGCGCCGTGGGCGCGCTCTCGGCCTTTTCGTTCCACTCCTGCTGC
TGCTGCATCCGCTCTTTCCGCTTCTTCTGGTTCTCCAGCGTCTCGCGGTACTTTTCCTTCTGCACGTCGACGACGTTCTGCTGCTTCTTGCGGAACCGGC
GCGACGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTCTTGACGGGACCATCGAGCTTGGCGTTTGCGCTCTCCATTTGGTGAAT
CTTATTCTGCTGCTCCTCGGCTGGGTCCATGTCCACGCGGCCGATCACTGTCGGGTCCAGCGTGATCATCTCTGGNNNNNNNNNNTCTCGAGCAACGCAC
GCACCTCGGTCTCGCCACGCTGCTTGGCGTTTTCGTACGGGTTCGCCTCGTAGGTATCAAAGTTCGGCTNNNNNNNNNNNNNNNNNNNNNNNNCAAACCC
GTGGAGTGGCCGACTGCGAGCACATCTTCGAATGGACGGAACGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCCGGGATCATGTACGTC
ATGTACGGACTCGGCGACGCCGTCGTGAACGGGTTCTTGAGCACGTGCACGTTGGGTCCAAAGCCAAGGGCGACGAGGCCCCGTTGACTCACACTCATGG
TGTTCGCAGCCGCCGTCAGGTAGTACTCGTTGAGCTCCTGGTATTTGCGCAAGTCGAACACCTTGACCTTGCGGTCCGCACCAGCCGTCACGAGGTATTT
GCCGCTGTTGTCGATCGCCATCGAGCGAACTGATGTCACAAAACACACAAGATCGCTATGAGTAAATGCCACAACCCTCCACATAAACGAACATAACAAT
ACGACGTACTTGGTCCCTGGTGGCACTGCATTTTCACGACCGCTTCCGACATGTTTGGCGTCCAGAGCGTAACGATTCCGCTCGCGTGGCCCAAGTTGAT
CACAGCGTTCCACGGGTTTTGCGCCATCGTGTCACAGAAACCCTGCTTGGTGCGATGCGTGGCGACCTGCTTGCCGTTCGTGACATCGTGATAACTCAGC
ACACCGTTGCCGCTGACCGTCGAGAGCAAGAAGTGGTACGACAGGAACTCCATGCGGCGCGGCTCCGGAATCGTGCGGATGCAGTGGGCTTCAGCGCCCG
TGCTGTCGTAAATGTATCTGTTTGTTATAAAAGCAAAAGCGCATAGATGGAGCATTATTAGATTCGCATAGCTAACCGGAAAGTCAAACATGAGAGAGAG
ACAAAAAAAAGACTTACACATGTTTCTTTTGCGCAGTCGCAAACAACGAGTTGTTGTGCAAGAACGAAATGTCGCGGATGAGGTCGTTGGCTTGGAATTC
GCACGTGAGCTTCATGCGCAGCGTGTCAAGGATCGCCAGGTGGCCCTTCTCACTGCCAAGCAGCATGTTTCGCCCATTTCGTGTGTAGCGCACACGGTAC
GCGCCGTAGTCAGGCAAGTCCAAGCTGAAGATCTTGCGCGCAGTGTTCTGGTCGACGTTCTCCGCGAGTTGCGCTTGTGTGAATTTGTAGGTTCGCTCGA
GTCCTTCGGCTTCCAAGAGCCCGGCATCGCTCGGCAGCAGGATCTCGGACTTTGCCGCAGAGATCGCAGCCTGTTGGTGCTTCTGGCTCGTGCGCGTCAA
GGTACCCTTGAGCTTCTTGTCGCGGATGCTCTACACAATCGATCCATCGCACCCAATCCATTGCCACAACGTCAGCTTACAGCATTATAACAAAGATATG
AACAAGTCTACTATCTATATCATACACACGCATAGAGCCCAAAGCCAAAACGCACCTTGATCTGCCTCTGCGAGAGCGGTGCCTGGCGGCTGTACTTGTG
GAGGTTCTTCNNNNNNNNNNTGGCCGCCGGCTGCTGTTGCTCAGCCGCCTTGCCGGCCTTCTTCTGACCTAGACGGTGCTCCGCCTGGCGCACGATCTGC
TCCACGTTCTCGGGCTCCGAGTCGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTTGCTTCT
CGCTGCAATTGTGTGACGCTTTGCTGCTGAAGCCAAGCGAGCGCAGCCAACGAACCAAGAGCTCCTATTAAATCGGTAGAGCTACCGCACCGCTTCAAAT
ACAAGACTCTTCATGCTATTACTGTTCTATACCCATATAATGGGCTTCTTTTGGTAGTCATTTTGTTTGGCCTCTCGTTAAGGTTTACAAGATCGTCCAC
CCGCTCACTCGTTGTTCGTCCGCCCGTCCGCTCCTTTCTCAGCGGCTGATTGATTGATAGGAAAGCCAGATGGTGCTGACTTTCTCATATGTTGTGCAAC
TGTATTACTACTGTACCGGTACACCATGCTTAAGTAGTGTAGATACAGTACTAATTAGGGGAGGGGGAGCCGTCCGCTCGCGCGCTCCACTTCCCGCTAG
CGTATGCTCGCTCGTCGATCCACTTTGAACTGCCAGTGCGAGCTTCACACACACCAAAGACACACACGCACACTCGCAGCAGTATGGGGCGGGTACGACG
CCAACTGGGGCCGAATGGCGCCGTGTACGCGCACTAACAAAAGACTATGTGTGTATATGTGTATTATCACGTGGATGTGTGTAGCGACGCGGTGGATTAG
GACCACGGCGCGCTTCGCTCAGTGCGGTGGCAGTGGCGCTCTTCGTGGCGACAGCGCTCGTCGCTATAGCAGCAGCAACGCATCGCTCGGACTCGCGTGA
GGGGAGACGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACCGGTGAGCGCACAGGCACGGCACAATCTGATCGGTACGACATGTTGCGTTG
TTCTTGATATTGCTGTTGTGTGCGTGTGTGTGCGTGTGTGTGTGTGTGTGGTTTTTTGTGGAAGCTGATGGAACGAATCCATGATGTGTGTCTGTGAATT
AGAATCGCTGTTGAATAATTTACAAGATGCTGGCAGTGGAAGCTTCTCTAGTTCGTCGGAATCCAGTAGTGGCTCGGGGAGTGATGCAGGTGATGAGATC
ACATTTCCTCGTGGTTCGTCGTCGTCGTCGTCGTCGTCGTCATTAGACTCCAGTGGGATGGGCGATGTAGAGGTCGAGTTTCCGTCTTCGTCGTCTTCAT
CCTCGGACTCCAGTGTAGCTGGAGATGCTGATATCGAAATCCCGTCTTCATCATCTTCATCCTCGGACTCTAGTGCTGATGGAGATGCTGATATTGAATT
CTCGTCTTCATCATCTTCGTCTGGTGACTCCAGTGCGACCAGAGATACTGGTATTGAACTCGCAACCCGTCCCCCTTCTCATATGAACCCTTTAATTAGC
TCTATGATCGGGACTGACGATGAAAAGCCAGATCCTGAGGTAGATCGGGACGTTCCTGGCACCAGTGCGCCTCCAGGGAAGACTCCAGTGCCGCCGAAAA
CAAAGTTTGCCGGTGCATTAAATGCGTTTCCGACACCAGGTTCGACTACTAGCGTTCCATCACCGGTTGTAGGAGGACGAACATGGAGTGCCAGTGCCCC
CGTCCCAACTCCGATCGTGACGCAGAAACCAGCAACCACAGCACCAGCTACGAAAACCCCTGTACCGATGACCGCCGCAGAAAATACAGGAGCTAGCTTC
AATGGATGCTCAACAGCAGGTGAGCTATTCGTCTTCTCTTGGGCGAAAAATTCTTGGTGGTTTACACGGAAGCGTTCCGCGTGCTCCATATTGACGTAGT
TTTTTGCACTTTTTTCATTTTTGCTTCGATGTGACAGCAAGCTGCATTACTGTCGTGAGCTCTAGTGTGAGTACGTTGTCATTGGTGGCAAGCAACTCGT
CACTTGACGGAAGCTCAAGCGATGCTACTATGGAAAGCATCATCATTGTGGTACGAAAATGACGCTTGGATGTCTATATGATTTCGATAATAGTTGGTGA
TGTCTGAGTGTTTATATGTGTGCGCACAGCCTGACGATACAAGCTCTGCTCAATCTTATGTAAGACTCACAACCCCATACTCGTGTAACTAAAGCCGAGG
GTATGCTCACTTTCTCACGTGCGGATTTATCTTTTTTAGGAATCAACAACGGTGATCACTCCATACAGTTCCGACTACTGCCGCTGCAAGGTCACAGAGT
GTCAGAACCGGTACCCTGGAAACTCAACGGGAGCTATGTGCGAAGCCTCCGTGGCGGGAACCTGTCGTGCTGGGTACAAGACGTGTGGTGAGTGCAATTC
GTCAAAGGTGCTGTCATATCACGAAACAACTCACCACTGATCATTATTTTGACTGTTTTTTGTTGATATTAGTGTCAACGGACTCGTACAAGCTTGACAT
TCAGCCAACGACCCCGAGCAGTGTGTCTGACATCACATTCACGTTGCTGGCTTCCGATATTGTTGGCGCATTCCACAATTTAGGTGACCAAAATCCATTG
AACAGAGGTAGCAACTGGTGGGTGATGATCAGTCTACCAACCAGCTGGAGATTTGTGGCATGGGAGATGACGTCCGTGGAAGCCACACTGACTGGCCTGC
AGAATCAAAATGCTGTGACTCGCACATCACAAATTCGGCCCTGCAGCTCGGTCACGGCTAAGACAAATTGCCCCAGTGAGCAGTCTCGAACTCCAGTCGG
GTTTATCAATGTGATGGACCTGTTGGAAGATGGTCAGAATTTGATGTCGCTGGCCTCCAAAGCGCCAATTTTATTCAAGCTGAAAAAGAGTGTCATCAGT
GGCCCAAACGGCGGATCCAGCGCAAGTATGAGCGTTATCCTGACGTACGAGAAAACTACTGGAGCTCTTGCGTCTACGTCGACGACCAGAAGAATGCGGG
AGATCAGCGTTGACGTGCTGACTGAGTTTTCATCTGTGGCAGGCACCAATTTGGCTGCGGTGGAGCTGGTGTCGATGGATGTTCCGAAGATTGACGACGG
AACCGTGCATTCCTCGTTAATTTGGATGGATGGAGACTCGAGCACACTTACGCTGTCGTTCTCTACGTCCACGGTGATTGGCAATACATCTGTTGATCCG
AAGGTTTGTGTCAACTTTCGGCCTTCTGCATGCAGGAACAAGGGACGCATTCCAACGGCCAATGTGACGTTTCAAGACCTGGCGCGCGCAGCATACATGA
AGGATGGAAATCCATTCATCAACCTGTATTCGTTACCAGGCGACGCTCATTTGGAAATCCAACCGGTGAATGAGACATACTTTTGTATCGGGAAATTGCT
CCCGACAGGCGCCGGCACCAATACCAGTTGGGAGATCAACTCGGATTTCACTTTCCAGCTGCAAATCGCAGGTATCATGTGGTCACAATCAAGTGTAGTG
GCTAACACTACAGGCCGCTTTCCATTGCCGGTGCTTGCAGAAGTGGTTCTCATGGATCAAGACGCGTTACAAGGAAGCGACTGTGCACAGCTGCTTTCGC
ATGAATCAACATGTAAGAAGCCTTTCATTTCACGTTTGAAGTATGGTGTCTATGTATTAACTTGTCTCATTGTTGCAGATTCGAACCATGGATTGAGCGT
CTACAGTGTGATGTCAGTGACGATCTATTCAGTTGCTCTTGTGGGAGCGATCCTCATTACACGAATGGTAATTGGCTTTTGTTTTTGCTGCGGTTGATGG
ATAACAAGCAGTTTACTCACGTGATGCTTTTTGTATCTTTGTAGAATGGCATTGCCTTTTCTAGCTCGTCGTTCTTCAACGATATGACCTCGATCATGGT
TCTGCTCGTGCTTATACTTGGGATTATTGGCAACGCGATCTGGATCCACGTCTCCTCCGACGCCCTCACCACCAACAGCAGCCATATTTACTATGTGCTT
CGACAGATCACGATGTGCTGCACGTGGACTATGATGGTCTCGGTCTGCTTCCACTGGCTATTGGTGCTCAGCGAGAGTCTTCGAAAGATGCGTCGTGTCT
ATGTGTTGCTCGCATATATTGTGGTGAATGGTGGATATTACACCTATGTATTGTACAGCATGATCACACTGACCGACTTCTTCAAGTGCACGTACAACGA
CTATTTGAAGAACCCACGATACACCAAGCGCCTTTGTGACAGCGACTATTGCCCCGATCTCCAGCCTTATCAATGGAAATATGCAACGGAAGAAGTGTGC
AAGTACGTACATGATTCGTCATGGTACTTCCCTGGGGTGTATGGCGGGGAAATCATGATCTTCGCGACGGGTATCGTGCTGTTGATATTGGGCGCCTACG
TCATTCGTCGCGGCTCTCGTCTGATTCAGCACTCTGGTGACATTTTCGACGACCGAATCACTTCGGTGATGAAGAAATCGCTGTGGACGTACCTTGCCGT
CATTGTTGCCATTTCGTTCACGCTTGGTCTGTCGTGCATTATGAATCTGCTTCTGTACACTCAGAACTGGAAGGTCAACGCCGTTGTCTGGTACGTGTTT
ACCATTTGGCTACCGACATTGATTCCTCCAGCAGGGTTCCTTGTACTTCAATGGAACCCTCGGCTGCACGGTATGAATTGGAATCCATCTCTGCACGTGA
AGGAGCGTACTGTAACGAAAGACAACCTCGGGGAAAAGGGGTGGGCGGACGGGAAAATGGAAAATTTGAGTGAGACCTGGACCGGGATCTCCAATTTTCC
CGATACTGAGTACGCCCCGATTGGCGCTGAAAGCATCGATGGAAACCAGAACATTTTAGCGCTGTCTATCCAGCTCGCGTCCAAGGTACCAATTGCGCAC
GCTTGCTTTGTTGAGCTATATGTGGCAGACCTCAATGAGAACGACGTGACTGGTGAGGATATTTTTGAAGATCTTCCATCAGCAGTCCGCCATCGATCAA
GCATCAGTTCGCTTCTCCAAACTGGCATCCAGCACGATAGCTTGATGAACAAAAGAGGCCAATCTATCTCATTGAGAGCTTCGCTTATCGGCATGAACGC
GTCAAGTTGGGTTCGTGTGGGCTTCACCGAAACGGTGCTGCCGACCTTGATTCCAGATGCAGAATCTCCCAGCTCCAGCTCAGCGCAGATTGCAACGTTC
TTGTCTGTCTTACAGGTTCCAGTGATGCCCTCGAACCCAGTTCTGCGATTCGTGGTGTATGAATTACCAGATGACATCGACACTTCGCCAACCGCGGATC
AATTTTCGCTAGAGCGACCAACTTTCAGCAGAAGATCTTCTTCGATGCAACTGGACGAGCGAGCTCGGCATGCGCGAGTATCTGGGATGGGACTGGCGCC
ACCAATGCGTCCTCAAGTGTTTTGTGAATTTACGTGCTCAGCCAGTGAGATTCTCGCGGCCGACGAAATGAATCTGATTGCTCGGGACGGATCCCATCGC
CGATATATGGCCAATGCTGCGTTTAGCGATATCCCGGAATCTCCATCTCCAAGTGATAGCGAACCACCGCAACTCCGAATCAAATCCATGACTGTATCCA
CGCGGACGCTGAAAGAAAACAATGGATTTTACATTACGAAGAGTTTCCAGTTTGCTGAAGGAAACGACATGGTGGTCGAAGATATGACAGAAAGTGTCTT
CACAAACGAAATTCCGCGACAGTACCTCGAGCTTCTCCGCACCGAGCGAGCCGACGACTTGGCCCATGCACGAGCAGATCTCGCGGACTTTGAGACGAAA
TGCAAAACAGGACTTGTCGGTGGATTATACGACAACCTCATCGATCAGATTCAGGTAGCGTGGTGGTATTGATGCTTGGATTTTGAGCGCTCTCATCTTA
CTGATTCTTCAAAACAATCTGTGTTTGCTTAGGGTGAAAATGATCAAACCGTGGTGCAAAGCTGGTTGCAAGACCGTGTGCAACGACGCCGGATGTATGT
CGATGCGCTCCGTGAGTGCCATCAAGTGTGCATTGATCGCGCTGAAGCAGGGGTTAACTTCAAGGCGAGCACAGAGAAGAAAAGCCTGGTGCTTCGATTC
CTGCCGATCAATCTGGTAAGTGATGCAAAGTTACACTATCTTGGCATTCTACCACGCCTCACTTTCTCTAATATTTTTTGTTCATTTATTAGCATGTGCA
AGATATGTGGGTTGGCCCGACAGCAGACCTTCGATCTCAACGAACGCGTCGAACATCGCCTAACGTGAAAGCGTACCCGACCATCACTGTCGGCGCTTTT
GCAGCCCACTGCTACAAATTTCGCCACGCTGGTAGCATCCTAAGTTTACGGAGCAAGCTGCAGAAACGGACATTGTCTCGACTTCACAGCGATCAGTCCG
ACCGTGGAGGCAGTGGCGTCGACAATGACCAAATGGATTGGACGAAAGCAGAAGTGCGTTCTCACGACGAGATCTTGTGGCAGCTCACCACTCGAATGGA
TATGTGCGTTTCCCAGGCATTGACTGCGCTAGTCACTTCGTTTTGTCGCTGCCTGGAACTAGCGCTCCAACATCCAACAGATCGCCAGTTCCTCCAATTG
ATCGATTCCATTGGCTTCCTCTTCCAGGTGGAGAGTTTGCTGTCGACACAGGGCAAGGAAATCGGTATGCTGGAAGACTTCTCGGGGTCTGTCGAGGCGA
TGAAGAACGTGACTTTTGTCCTGGATACGTCTCCTCCACGCCATCTGCCGTCCACGCTCAATCTGCACTTGAAGAACACGAACCTACCAAGTGTCGTCTC
TGTGCGAGTCAGCAAAGGAGCTGCCAGTGGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCGCTGCAAGGAAGAGGTTTTGGCTCATCTTC
CGAAGAATCTTCGCAACGGTGGATCGATTTCAGTCACTCCCGTCATGTTTACCCAGGGCATCAATGAAATGCAGACTTTAGCGAACAATGCGAGTGGGAA
GAAGACCAACCTCCAGGACACGATCAACCAGAAAAGCTTTCGTGTGCTCGCTGCATATATCGACAAGTACACGATGCTTGCGACGAAACAGGTACGCTCT
CTCTATCTCTACTGCGCTCGACATTGTTGCCTATCCGTTTGCTGAAGTTTGTTGTTGTATTGTGTATTTTCTGACAGCCTGATGCAGTGCCAACGCCGGT
ATCCACAATCCTACCCCTGCTTGTATCGCTTGAAGAGCGCATCAAGGCCGCCAAGAAGCAGGTCGTGAAAACAAAGCAAACCAAGATCATTCAGGAGAGC
TCCCGACTGTGTCGCCTCCTAGGCGCGGGTCGCGTGACGTCCTGTAAAAGCGCAAAGGATCGCACGGGGATGTCGGTCACGCTGGAGCAGATCCAGTTGC
TGAGCGAACACCATGGCTTGCCGCAAGAGTTTGTGATCCGAACCGTGTCCACGATGCGCAGTAACGGCGTGCGACTTGAGAATGCGTTCAAGAACACTGG
GAAGCGCCAGTACGCGTTCAACGCGCTCCAGCGCTCTCTTCTCCCGGAAGAGTACAAGTGCCCCGAAGGCACCTACGGCCGAGGCCAAGTGAGTTAGCCT
CAGCCGTGCACAC