Description :
From Genome Similarity Track
Location :
Scaffold_425:11166- 12248
Sequence
1082 bases(100 bases per row)
GACGGCGTCGCCCGGCGTGTTGGAGCCGCGCTTGAACTGCAAGTCCTGCGCGGCGAGCTGCGCGACCCAGTCCCAGCCGTACTTCTCCACATACCGAGTG
TACACGAACAGCGCGGCGTCGTCGTCGTGCGGGTACGTCGAGGCGATGTGTCCGGCATACTGAGGGTCGATGAGGTCCTCGGCGGACTCGGGAGCATCCA
GCCCCGCGGCCGCGAGCCGCTNNNNNNNNNNGAAGAAGCTGAAGGTGCCGACCATGTGCGACATCCACGTGCCGTTCTCCGACTTGAAGTCGTCATAGAT
CTTGGAGAAACCCGCGGGCTTGTACGCGAGCAGCTTGCCCTCCTGGTCCCAGCGAGGGAAGTTCTGCACTGTCTGGAGCGCTGTGATGTCCGGCACGAGC
GTGTCGGTGTCGAGCTGGTTGTCGATGCGCACGTCGTGGTACTTGGAGTAGTCGACGACGATCGTGAAGTTGATCTCCGGGTACGCCGCGACGAAGGCGT
CATGGACCGCCGTCTGCTGCGACTGCAAGTCGCCGCCCGCGTAGTACACGAGGTTGCCACCTTCGGCGATGGCGTCCTCGTAGAGCTCGTCGAGCGTCTT
AGTCTCTTCCTCGACGTCCTCCGCTCGCACGGTCGCGGCAACGAGCGCCGTCGCGGCGAGGAGCACGGTCAGCTTCTTCCCGAAGATCTTCATGGCTCGA
GCAGTCGAATGCGCTTGGCAGAGAGAATTGGAAAGTGAGCGTCTCCAACTACTACCGAGTCGAGCACCGCACTCGTCTGGTGGTCCGTCGTAGGGATGGC
GGCAGTGGCGGATGTCGTGGCAGTGGATGTCGTGGATGTCGTGGCGGCGGTGGTGGTGGGTCGTGATGATGGTCGAGACAAGGCCATGATGTTGCTCAAG
TGCCGCTCGACGGTGACGACCAGGCATCAAATGCACAGCGGACTATCCGCATGGCGGGAGCCGTTTTGCCAGACGGNNNNNNNNNNNNNNNNNNNNNNTT
GTTCGGATGGTGAAAAGCCCGCAGCCCGCTTTCGTTGAACCATGACTCGTGTCCGATTTGCAGGGCAGAAACGCGGGCACGG