Description :
From Genome Similarity Track
Location :
Scaffold_210:11164- 19979
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19890hypothetical protein
Phypa_INRA-310PPTG_19891hypothetical protein
Phypa_INRA-310PPTG_19892hypothetical protein

Sequence
8815 bases(100 bases per row)
CGCTAGTCTTGTACAAGAACGAAAAGATAATCTGCGTCAAAGTCGGAAAACAGGTAAGTGTTTTTAGACACATCATCAGCAAGGAAACTCATTTACCTGT
AGACCACCAACGACAACATTTTCGTCTACGCAGCGTTCAGCAGCGAGCGCAATTCTTGAAATGAATCCCTGTGATTTCCAGCTTGCGAGGACACTGTTCT
CCGATCGCGATATGGTGCTGCAAAATAAGCGCCATCGTTTGTTAGAACAGCTGAAAAAGCTAATCAAATAACAATCAAACCCAACCTGAGTAGGACATTG
CAGCAGCAAATACGAACTTGCAGTGGTAATTGGTCGTATCGAGCTTCGCTCCACATACTATCGAGCAGTCTTTGCACTCGTGAGTCGATGCCATCAGTAT
CACGAGTTTTACTGTTTTCTCCGTTATCTCCATTCTGGATCCCGAATATCCACGCTATCAGCAGGTTCATAAGTGATGCAGCACTCGGCATTTTTTTCGT
TTCTTGTCCGCTGTCGTTTGCTGCAAGTCTGGAGAGTATCAACGATATGCAATCTATGCAACCGCGTTGGAGGTCGGCAACGAGTGAATCATCGGCCGGA
AGTGCCAGGATTTGCACCAGCACTGCAATTGCTTTTGAACTGATGTCACAATCTTTGTAGGCGTGTTCATCCTCCGAAAAAACTCTGTTGAGGTAGTACA
CCATCAACTTAGCTGTCACCAGTCCACAAGAATCTGGAACGCTGTCGTCTTCGACAATACATGAACAATCTTGTTCTCCGTGAGGGGTTGCTTCTCGCAA
GAATGCAACTACGTGTGCAAGCACGAACGGCATCACAAGTGGGGGAGGAAACTTGGACAAAGACTCCGTTGCGAGCATCTTGACCTCCTTGAATTCCAGT
GGATCCACCACGGAGCGGGCAAGAATGTGAAAGAGAACTTCACCCGTGGCACACGCCTTCACTTCAAATTTAGTGTTTAGGTCGCTGTCATCGACCTGTA
GCTGATGGTCGATATACTCATTTAGGTGATCCAAATCCTCGCGCCCACACTACACAATAACGTGAGCATTACACAAGTCACCAAACTGAATAAAGAAAGC
AGCTGTAAAAAAGATTTCCTACCGACAGCGTCTTCATTTGGACGGATCGAAAGACCTCTCTAGGAATCATTCGTAGCACTAGCAGCGGTGCTAATCCAGA
AAATAGCAACCCCTCAATATTTTTTGCGGCTGAGGGCGAATTATCATTCAAAGACTCTTCAGTTAAACGCGGAACATTCTGCAATAGCCATGATATCATA
CCACGTTTTAGCTTGATCAATAATGACTCGACGATCCAGTTTAAATAACTTACCATCATAAAGGAGCAGATTTGCCGCGCCATGACTTCAAATTCTTCAT
GGTTCACCCAGCCACACGCCGTAAATTCACGCAGCATTCTTAATAGCACAGGATCACGAGGAGAACCAAAATTCTTGCGAAGTAGGATGCACAAAACTTC
ACTTCTCGTATTTGTCGCTCGGAGATAATTGCTCCACCTGCTCGGAAAAGGTATGAATCACACATGGTTAGTCATTGAAAAGGTAAGAATGACATTGCAG
TGAAGGTGCAACGTACCCCGTTGGGCTGAAGCACAATGAAAATAGTCTCTCTTGCAGCTCCTTCCGTTCGTCGATAGCAGCATTTTCTTTAGCACTTGCA
CCCAGTTGGGCAACGTAGTCACTCCAATCACGAGGAGCTGTCAGCATCTTACTAGAGATGAAATGGGATTGAATGCTCCCAAACTGGCACGCATCAATAT
ACCACGACACCATTACCTCAAGAGATTTCCGCGTCGCAGTCGAGAAAAGGTATCCAAGTGCCAATGAGATGACTTGGCTTCCAGCTTTGTGCATAGCGGT
TGTGGTCAATCCAGCGACGCAGGACAAAGCGTCAAGTGATGGCAAGCATGAAATAGCCTAGAGATGAACACATGAGTCAGTTTTCGAGTTTGTTGATCTC
ATGCAAACGACTAGACTTACCAGTCGCTGCACACTGTAGTTTTCGTGAGTGATGAGACACAATACGCCCGGCGTAAGCTGCTTGCTGCTCACGACCAAAA
AACGAATTTCTTTCAGTTGTTTGTATCAAATATATTCTCCTCGAGAAATCCTTACCGCCAGTGTCGATACAGCGGTGATTGATTAGTTGCATTGTCGAGT
TGGTATAGAAATGTCCGCACGAGTGAAATTGCATTCTATGCAGCAGAAATACCACAACAAAGCAGGTATTAGCGCACAGGAATACAATAGTACACCAGCA
ACGCCCACTCACCATAACATTTGCAGTGTGGGTGCCATCTACTCGGCATACAAGCTCAGTGATCAATAATCCACGAGAAATAATGAAGTCGGCGACAAAC
AACTCCAATTCTGTTTGAGCTTCCGATCCAATATCAGAAACCACACGCGTGACTGTGGACCTGCCGTGTGAACGAAGCAACTGCGAAAGAAGACCTTGTT
CTTCGTCTCGTGAGTCCAAAAGGCTGAGTGAATCACTGGGCAACAGTAGGGTTCTTAGGACTTCTAAAACGAGTAGAACTGTCGTGTAGTTGCCATTTTT
GACTGCCGTAGTCAAACCGTGCACAAAGAAGAAAACAAAGTTTGCCTTCATTTCTGCTGAAAAGTCTCCAAATGCCTTGGAACATCCTTTCACTCCACCA
ATTGAATCCATCAATAGGCACACGTAGCGTAGTTGAGCGTTTACTACCTCAGGGTTAACAATGCCAGGCTTATCTCGGGTTGCATATGTATCTGTAGCCC
ACCTCTCCAAAACTCGAGCAAGAACCTTAGACGGCTGGTGCTTTTGGACTCGAGAGAATGCGACAGAGCGTGTGCAAAGAACTGGGGCGGTTGTCTCCCA
ATGCCAACATAGTACATCAAGCACGGTTTGGTTATCTACACCCGTGTTTCCATCTCCATTTCGATTTTTACTTGGCAAGACGACATCACAAGCAGTGACA
TATGCTAGCAGATGTTGAATCGCATACCCAAGTAACTGTCGGCGTGTTGAGTGTAAATGCCACTGCCGTAGCGTCATAAGACAGAATCGCATGGTCTCCA
CCACTTTGTGCATCAACTTATCGTCAACCAAACGCGTTTGTGCTACTTCATTGGAGATCAAATACTGGGCAGCGACGTCCCCACTCAGCAATATAAGCGT
TTCTAAGGCGATCAGCGCAAGCTTGGACGGTTTAACACGATGCAAGTCAACCCGAGTAGTTCCTCGTTCTACAATATCACGAATTGCATCCATGTATACC
TCAACTTGATCACCCAGCAGGCAAACATTCTCCTCTCGTGCTTCGAACGTCTGTAACTTGGAACGATGCCGTTGCAACAACTCAAAAAGCGTAAGACAAG
CAACCAACTGTTTCTGCTTCTCGGTAATCGGCTGCATCCATTCCAGCAGCAACTGCCGCGCATAGTCACAAGTAGACACTGTTTTTCCACCACTTTCACG
TTCGAGGTTCATGATCCACTCCAGCAATATATGCATAATCTCCGCTTGTGACCCCCAAATGCAGCAGTTCGTCCGAGACGCCGTGCAATCTCGCATCGAC
TGCATCATAGCAGCTCCAGCCACCATGTGCACTAAATTTCGGCTCGAGTTCTTTTTTCCTGATCCTTCACCATTATCTTGAATGTCATAGGCATTTCTTA
CTGTAGTCAAAGCAGCTTGCAGTCTTGCAATCCGCTTGTGGTCTGACAGCGACAGCACTCGACCCTGAAGCAGTGAACAATCTAATGAATTAGCAACAAT
AGTAACCGGCAGCACGACATAACACTGCAAATTGCTAATTGATACCTCAGGAGTGCGTTTCAGCACGTCCACGTTGTCCCCGCCACTAGGTTTTAGCAAA
GACTCAGAGCTGGTCCTGGGTTTGACACTGACCATCGCTGCCTCCATCTACACAGTCACGGCGTGTCATAAGTCTATTCCTACACAAAAGGGGAATGAAA
GTGTGTGGATAGGTTGGAGGCCTTACGTGGAAGAGTTCGCAGTCTCCTAACACGCGAAGCAGTCGTCCAGCGCTGTTGCCATCGCTAGTCCTCGCCATTT
TGCAATGACACTTGAAATGCAATTTTTCTTATAATTATGTGGGTCACATTAATTGAGTTGTGTTCGATACCAAGACAAAGCGACGACTAGGACGTTGAAC
TGGTTGCACATTGTGATTGATACCAACTCCATTATACATACAGATACTCCTAGAGCTGGTGGCTTTCCTATCACTCGGAAGCGAACGCATTTAGAGCGTT
AAGGTATTGGGGTGGTCGTCGCGGCGGACTTTGTCGACGTCATAGTACGACGCACTATCGTCCGAGTGGGCGCTAAGGAACGACTGGTTCGATGACTGGT
TCGAGGAGCCTGTTCCTCGTCGACGTGAAGGGTAATACATGCCATCGTCACTACCATTGTCAGTGATTCGACTCTGGGCATTGAAATCCACACGAGATGT
CGCGAAATTGGCCGTCGACTGGTAGCCGTACGAGTCCATCGAGTCGCGCGAGAAGGCTGACTTGGTCACACCAAGCGGACCAAGTTCGTAGCTCTGGCCT
TCCACATCGTTGGCTTCGTTTCCATCCTCATCCGTACTGACCACGGTCTTTGATCGAGCCTTGAACCAGCCGCTGCTGTCCCCGTCAAAGCTGTTCTCCG
AGTCGTTCGAGAAGATCGACATCTTGGCCTGAGGACTGCTACCATAGCCGCCACTTTTGTTGGACTGATGAGCAGCAGCGCCCATCGCCGCTGAGAACGT
GTTGTCCTGCTTCACGGTGCTTTGGCTGCTGACAGACGAAACCATCGAGTCCGAGAAGTTGACGTACGACTGCATCATAGCCACCGAGCTGGCTTGTGAC
GCACCAGGAGCAAACTGCTGACTTACACTCGATGCACCAGGATTAAACTGCTTGCTGGGCGCTGAAGGCGCAGCTGAAAAGTCATCGATATCCACATCGT
CAATATCCACATCCTTGCGCAACGAATCCATATCAAAACTACGTTTCCGTCTCGACGAAGAGCTACTGACACCCGAACCGGAGAAACTCTCTGCGTACGC
GTCGAGCGGCACCGTCGATGGACGTGAGCCAACGCCCGATCCGGACATAGCAGCTCCTCCTCTCGATGATTGACCTCTCGATGACGGCGGACCCCTGGAC
GATGCCAAGCCTCTCGAAGAGTTCTGACCTCTTGAAGAATTCTGTCCTCTTGACGAGAGCTGGCCTCTCGACGACTGTCCTCTTCCAGACTTTGGTGACG
TGGAGTATGCAGCCTCGTCACCAGTTTTGTTCGTCCCGAGGTAAGCTGACAGTACATCGTACGTCGGAATTTCCGGTTCAGGTTCAGGAGCAGGGGCGGG
AGCTGGTGCAGCATTATTCACTTCAAAGGCATCTGCGCTACGCGTCGAGTCTCCAAATGAGTACTGCTGGTTGCGAGACACCGGTGGACGAATCTTTCCT
CGTGATCGACTGAAGACCGGGACAGGCTCTGGAGGTGGCTCCAGCATTGGTACATTATCGGAGTGTCCACTGCGGGAGCTCTGAGTGCTGTAACCGGACA
TTGCGCTAGTCTGCGTTTGGTACTGTTGTTGCTGTTGTTGTAGTTGCTGGTTATGCCGTTGTTCTTGTAGCTGTTTGTTCGCGTACCAATCCACACCCTG
GCCTGCTGGTGTGTTCTCCACCTGCTCGTAACTGCGGACGTTGGTGGACATGTTGTTTCCAAACTCGAGATTGATGTCAGTAGCATCCAAGCTCGAGTCC
TTGCCGTTCTTCTTATGACGGCAGGCGATAACCATCTTGTGGACAATCGTGTATGCTTGGCGTACGAACAGTAAAAAGAAGATGAAAATGTTCACTCCGA
TGATACCGTAGGCCACATTGTCACGCACGTTCTGCGGGAAGTAGTCGTCTCTGGCCACGATGAGCATAAGGCAGATAAGCACCACCTTCATGAATACCGA
CGCGATACCGATGTAGTACAGGAACCGCAGCAGATTCGGCTGACGGATGAGGAGCAAGATCAAGTACACCATCGTAATAGCCATGATACATAGCAATTGA
GTCGTGGCATCGCGAACAATCCCAACGATCGCTCCAGTCATGACTGCCAGGAGAATGCGAGGCACGAAGAAGAAGCGGTTGTCGAAGTTGTACTCGTCGT
AGTAGGCGCTGTATTTGCTGCTGAACGCTCGCTGGTCGTGCTCATAGGTTCCCACGTCTTTAAGTTCATCTGTGTTGTTCCCAACAACGATGATACCAAG
TCCAAGAGCTAAGAGCACAACAGCCGCAAGAGCGACAATACCCAGTGCGTATCGTGAGCTAGAACCATTGGCCGAGTCATTTGAAGATCCTTCCGAAACG
AAATAACTTCCCGCCATTGCGAACATGTACTGAGCCAACAGCAGAGCCAGCACACCGGCCCAGATAACCTTGCGATACCATTTACGCGCCACTTCACCGA
ACGATTCCTGCTTGGACATGGCACCCACGACCATGACGAACACCAAATACAGCGCGTGCAGCACTGCAATCACAACGACAAAGGTCACGAGTGTGTAGAA
GAAAAGGTCATCGGCATCAACGCCGATCAGAGCGGCATATCTTGCCGGTCCTGACTCTCCAGCAGCGGCGACAAAACCTGTCGCGCTTGAGCTGGAATCG
TCTAGTCTCCGGGTTCCGTCGCTATCGCTTCCACTGCTGCTAGAGTCATCGCTACTTCCTTTAATCAAGTTGAAATTCGTCCATGACAGCTCCTTGGAGA
ACTGCATCAGAAACGTCGGGGCGCCTTCAATTCTCAGTTGGCTGATCATACCAACGAATTGAGCCTGCTCGACGATGTGCGTCATCTCATAGAAGCCTCC
GGAGAAACTCAGCGCTGCAGCAGCGCTGGGCATCGCCGAAGCCCAGAGGATCGAGCCTGTACCAATCACTGCCGCGCCAGCCAAAGAGGTGGCGATGACA
CCCGACGCTGTACTGCCGGCCTTAGAGTCCAAGAAATGCAACGTGCCTGTGGTGTTGGTAGGCCACTGCGTGTTGCTACCGAAGACGCATCCAGAGCAAC
TGTTGGCCTCGACGTAACTGGCGTTGAGGTCGCCAATATCGACGTCGGACGCGAGGTTGAGCGCCTGCCGAATCTGGTCCTCGCCCCACGGGATTGCGTA
CGTGTAGAAAAGCAGGCCAAGCGCAGCCAAAATGCCCAGAGGCAGCAACAGCGCGCAGAGCTGTGAGAGCGCCATGCAGCCGCAGCATTTAGCGGCGCAA
CACAGCAGTCCCATTGAGTCGGATCGTTTGGAGCTATTGGTACGAGGCGAAGGTGACCCTCGTGGTGGTGGACCTGCTGAAGTGGAACTGGCTTTGGATG
AAGAAGGGCTTTGCTGTACGCTTTGATAAGCTTCACTTTTGACTCGCGGCGCAGAGGCGCTGGAAACAGAGGGAGCAGCACCATCGAGCTTTGGATGGGA
CCACGGAACGAGAGACCGTGGCAATTGCAAGAATTCAGCTCGAACTGCTATTTTATTGGTAGAAACATTTTAATTTGTATCAAGTTTGAAGGGATATTGT
GATATTTGACCAATTGATATGCGCGAAAACTATTCAGAGGCATTTCGGTGCAGGTGGGATTTTGACGAGTGTGTGAGACGGGCTAGGGGCGCTTTTGACA
AGGTCTCCACCACTTTGAGCAGAGGACTCGTCGTTCGCGTCGAGCAATCGTTTGCATTTCCAGCAATCTCTAATGAAGAAGAAGAGGGCATGACAGCTGC
AACCATTGAGTATATTGCCTCCCGAATTCGCGAAGCTGCTATAAATCTGCTAATGATTCTGCCTCGCTGATCGACAGGGTAGTTGCTAATGATCGCACAC
AGTGGATTCAACGCTGTGGCCGCGCTACTACATGTACCTGAAGTCGTTGCTTCCACCGCGTCACTTTGGTCGTTAGCTGTTGATAGCTTTTACAGTCGTC
TCCTCAGCGATGTGAGAGTCGACGATGTGAGGCCTGGGTCAAACTTTAAGCCTTGGACGACGAAAAAACTGTCGACGGATCGAGCTGCTTCAACGTCATC
GCCGATGCAGCACAACGTGTGTCACGCACCATACGATGAAATGAGATGTGGTTGACGTTTTTGGCGTTCTTATGTTTGTGTTTTGGTTTTAATAACTTGA
TTTAACAGTTAAACACACCGTAGTTGATGTGGACTACCTTGTATACATATTGTATACTCTAGCTATTTCTAAACGGCAATCAGTCATTTCTAACCAGGAC
GATGGACAGCGCCACGCACCCATTCGAATGGTACGCCTCATGCCGACTGCACTTGTATCGCAGCCCCGCTGCTGATAAATCTAACACTTTGCCTGCTTTG
TTGCACGAAACGCGCCTTCGCAGCGAGATTAACCTGAGCTTTCCTGAGGAGGTAGATGCGCAGTATGTGCTGCAGACGCTTGAGGTCGACGAGGAGCTCC
AGCCGGAGAAGATCCACCGCACACTGACTGTTAAGGGCGCCGAACTCCACGTGTACGTTTTAATCTGACAACATTTGTCTGTAACTCTCATTCCGTATAT
TGGTGCTGAACGCTGTTATGCCTATGCCTGTTTGCTGCTGGTGAATTGGTGGTGGGGATGCGGTGTAGGCACTTCGAGGCTACGGAGATTCGACTGCTGC
GTGCCGCTGTGTCTTCCTTCTACGATATGAGTGTGTTGACCGCTAGGGCACTGCTGGAATTCAAGGAGTGAGCAAGTCTAGGTGAACGAAATACAGTCCC
AGCGTTTGACCCATT