Description :
From Genome Similarity Track
Location :
Scaffold_178:11160- 13638
Sequence
2478 bases(100 bases per row)
TGCGAAGACGAAGAAGCAGCGCTGCGACGAGCAGTGCTGGGACTCACTGAAGTTAAGTCCCTTCTACGATGTTCTGCTGGAGCACAACGATGTGCTCCCG
GAAGAGATCCCTGTAAAACTCTCGCAGGACAAGGGCATACAGCACAAGATCGACCTCGTGCCGGGTACGAAGTACTGCGTGACGCGGCAGTGTTCACTGC
CGCGTGACCAAGTGTAGACAGTCGACAACTTCTATGAAAGTCGTCGTAAAGCGGGTCAAGTGCGGGAATTAAAGTCGCCGCACAGCGCACCAACGTTATG
TGTCAAGAAGTCACAGGGGGGATGGCGCATCATTCATGCTTACAACAAGCCGAACGATGTAACGATACCGGCGCAGACGCCGATACCACAAAATATGTTA
TCATCGATTCGATGGCCAAGAGCACCGTCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTGATGCGTGAGAGAGCCATTCCTCTCACATC
GGTAAGCACGCGAAGCGGTATGCTCTGGGAGTGGCTCGTAATGCCGCATGGTCGGAAGAACGCCCCTGCAACCTTCAATAGATGTGTGATGTGCTACACA
TCTATTGCGCTCAATGCGTGACAACGCACCGAGCTACTTCGATGACGTGTTCGCTCACAGCTGGCTGTGGACGGGGAGACTGACGTTGAGGTGCACGAAG
AGCACCTCCGTCAGCTGCTAGGAATTAAGCGTAAGCGTAAGATCTATGCTAACCTGAAGAAATGTATCTTTGGGGAGAGCGAGAAACCCGTCCTTGGGTG
TCTCGTTGGGATGAACGGGGCACGCCCTGACCCAGAAAAGGTCAGAATGATCAATGAATGGCCTACGCCATCCAACGGGAAGGAACTGAGGCCGTTCATT
GGACTTGCAACGTACTTGTGCAAATACGTTGAGAATTACGCGGGCAAGATTCGCCCACTGCCACAGCTCCTGAAAAAAAGAGGCTGAGTGGATTTGGAGT
GCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCAGAGCTTGACTGAGGCGCCGCTCTTGGAAGTGGCTGACAAAGATCGGCCATTTTTCAGCGTGTGTG
ACGCGTCCAATTATGCAATCGGATGAGCGTTGTTGCAGCACTATCACGGGTGCCGTGATCGAGTGGTCTACTACCAGTCGCGTCAGCTGAAAACAGCTGA
GCGTAACTACCTTGTACATGACAAGGAGCGCCTTGTCATGAAGTATGCACTCGCGAAGCTTCGAGTGTATTTACTTGGGAGTAGACCGTTCGTGGTCTAC
ATCGACCACGCTTCACTGCGAACAGCAGTGAAGACTCCGAGCATCTCGCAACGAATGGCGAGATGGTTGTCATTCTTTGCGGACTACGACTTCCAGGCTG
AGTACAAGCCTGGACTGTTGAAGGTGGTGGCCGACGCGCTGTCGCGTCGACCTGATTATGCTGTCAAGACAGCCGACGTCAATCGAATTGGCGTCGAGCG
AGTAGGTGTTCCGTCATCGCCATTGATTGACGACATGAAGAACGCGTATACGAAGACACAGACGCGAAACATATGCTATATTATGTTCTAGCTCCTTCGG
ACGTGTCACGTCGGAAGTTGTAGCCACATCTGCGAGCCCGTCCGTACCGATATCGTGTGCACGAAAGACGGCTGTCTTACAGCGCAGTGGACGACGATGA
GGATTGCATCGTAGTGCCGAATGATTACGATCTGCGTATCATGATCATATACGAGTATCACGATGCCCCTACGGAAGGGCATCTGGGCCGTGAAAAAACA
TACGCTCTTCTCACGAAAGACTTCTACTGGAGCTACGAGGACAAGTGAAGGCGCAAGTACGTATGTGCTTGCGAAGTGTGCCAGCACGTGAAGCCTGCTG
CGTATTCGCAGGCTCTACTACAATCACTACCGACACCGCCAGAGTGTTGGCAGTCTATTTCTATGGACTTTGGTTTCGGTCTTTCGCCGTACAACAAGCG
GAGGGGTGAGCTTTGTTGCCTGATTTAGCAAGACGGTTTTGTCTTGCTGCAGTACCGGATGACGTCACGGCCGTGCAAACTGCACGACGGTTTGTTGACC
TGTGTTTCGACACCATGGAAATTCGCTCGACATTGTGTCGGGCTGTGATCCACGCTTTACATCGCGGTTCTAGCAAGGGTTTACACTTCTTGGAGCACAG
CTGTCAATGCGACTGCGGATCATCCGCAGACGGACGGACAGACCGAGCGCGTGAATCACGTATTCGGTGACGTACTGAAGCGTTACGCCCACTCGTTTTA
GCAGTGGAGCGACAGCTTGCCAATGGCAGACTTTGCCACCAACAGCTCGATGCATAACTCGACAGGTCATACACCGTTTTACGTGGATATCATACGGCAT
CCACGCCTTCCGAGCTTACTCGGAGTGGTGAGCTCCTCCATAAATGGAGAGGATCTACGGTTGCGTCGAAACGACCGC