Description :
From Genome Similarity Track
Location :
Scaffold_361:1116- 4049
Sequence
2933 bases(100 bases per row)
CTCGATTATGAGACCACTACCAGCTACAAACTGGTTCTACTGGTGAATGATACGTCGTCCGGAGCGGTCTATTCAGGATGTAAGGTTCAAGTGAGCGTCA
TGGACGTCAACGAACCTCCCTCCTTCACGAATGCTGGGTTCACAGTTCGTACAAAGGAGAACCGTTTGCCACCGATCGTCTTGTCACCGCAACTGACTGT
GTATGACCCAGATGCGTTTGACGCGTTCAAGTTCTCTATTGTGTCTGGCGGATTTGGCAACTTCGTCATGGGTGGATACGGAAACATCATTGTGAACAAG
CTTCTAAACTACGAAGCTCAAAGCATTTATAACTTGAATGTTTCCGTCATGGACCTTGGCGGTTTGACTGCGTTTGGGGTGGTCACAATTATCGTCGAAG
ATGTTCCGGAGCCACCAACATGTACTTCTGCGTCTTTTAGTGTGGCAGAAAACGCGGCACCGGGCAGTGTGATTGGCGAGTTGAAAGACCAAGTATTTGA
TCTTGATGCGTCAGATGTTATAACGTATGTGTTGGTCGCACAAAGTCCTCAAGGTTCTGTCAGTATCAACTCAAGTTCGGGTCAAGTGATACTCGTAGGC
GCTCTCAATTACGAAGTTCAAGAATCGATTTCGCTCCGCGTGAAGTTTACAGACTCGACTGGCCGACATGAGACTTGTGATTATCGCATCACCGTTGCGG
ATATCAACGAAGACCCGATTTTGTATAGCGGTGTCTTCGACGTGAACGAAGCTTGCAGTGGTGATGATTGCTTGATTGGGGATCTATCAGCATACGCATT
TGACGAAGACAGCGGTACGAAGTTTTCATTTACACTCAAAAACAGCACAGACGTTATGTCAATCATCGACAGCGGATTATGGGTGACTGGAGTTATCGAC
TACGAAGCCACACCCGTACTGTACGTTAGCATCGAAGTCTCGGACGGCAATGGTGCGCGTGCCACCAATACGATGGTCGTGTTTGTGATTGATGTGAATG
AAGCGCCTGTTGGAACTACTTTTTCTATGGAAGTCGTCGAGAATCAACGCATTGGAGCTGCTGTACTCTCGATACTTGCGACAGATCCCGAAGGTGATAG
TGTTGATTTTGGAATTTTAAACGCGACAAGCGGATTTTCCGACTTGTTTGAGCTCGTTGAAGGCGCGATCGTAGTATCGGCTGCAATTGATTACGAGTCT
TTGTCGACTCATTTGTTCTCGATCTTCGTCCGCGCGTGTGATCCACTCGCCCTATGCGTGGATCTTGGTCCAAACTTCCTTAATATTGTAGATGGCCCCG
ACGCACCAGTGTTTTTGGCGGTAGTGAGTTCGACAATCGAGGAAAAAGAGACTCCTGGTTTTGTGATTGGAGCGCCGGTGACTGCTGTGGACCAGGATGC
TGGCCAAACTGAAACCCTGGTGTACGACATTTTCTCCGGCGACCCTTTCAACCATTTCTCGATTGTGACTTCTTCGGGACAACTGACTCTCGCCGCGACT
TTAGACGTGAACATTATTCAGCTGTACTCTTTGGTGATCCGAGCAACAGATACAACTGGGCAGGTGGGGTTATCGGATCCTGTGGTGATTGAAGTATTGG
ACTCCCCGTCTCCGCCGTACTTCGTTGACACTCTCGACTCACAAAGCTACTACTCAGTTGATATAAATCGCTTGAGTGATGGTGCGTACATGACAGTGTC
GCTTACGATAGATGACCGAGATTCTGACCAAGCGGGTGGCTATTGCTCAATCCAAAAGGACACGTCTGGAAAATTTGTGGTCGAAAGCAACGAGGATTAC
ACGATCTGCAACGTGTCGGTGAAGCCTAATACCAACTTAGCTACGGGTGTTCGTTATAACGTCACGCTACGCGCAACAGATACTGAGGATGCATCATCGT
ACTCTCAAATTGTGGTTGGGATCATGTCGCGTGGTGTGAATAATGCTCCGCAGTGCACAAGTGCAAGGATGGAGCTGATGGAAAACACCCCCTACGATTC
TTTGGTTGGCAAAGTTATCGGCAGTGACAAAGATGCCGGTGATACAATTTCTTTCGCGATATCACAAGGGGATTCGTACGACATGTTTGCTATCAACGAT
ACGACTGGAACCATCTCAGTCGGCACCAACATATCGGACTATGAAGCATGCAATCTCTTCACCCTCGTGATTCAAGTTCAAGATGATGCTCCAGCCCCGC
TCATGTCGCAATGCAAAATTACAATTGTGATCTTGAACGAAATCGAGCCGCCTGTGTGCTCAAGTATGGTGTCGTTCAGTATTGCCGAAAATAGCGCTGT
AAACACTCTAATTGGCTCTGCTTTGTGGAAATCATGCGTGGATCAAGACACAAAAGTCACCACTGTAAGCTCTTACCTGTTTGAAATCCAGGATTCAAAT
GCTGTCGTCGCTGTGAGTCGAGCGACGGGGCAACTGGCATCTCTACGCGTATTGAATTTCGAAGCAAAAACGAGTTACAATGTCTCCGTGTTAGTGAAAA
ACGTCCGTCTCGAGAAAAAAACAACTGTGGTTAGCGTGCTTATTCAAGTTACTGATGCGAACGATCCCCCTCAAGTCACGTTCACGCCAGTCAATCCTGG
GTCCTCAGCAATGATGGCTAGTATTGTGGAATCAGCCCCCATCGGATCTCGTGTTGGGTATATATTCATTTCTGATGAAGATGACAAAGAGTATTTCACG
GTGAAACTATCCGACATGTCCGTTGTGTTCCAGCTAGCACAAATAAATGAGACATCATACGAGCTGCTGACTGTAGACACACTGGATTTTGAGATGCGAG
TCTCTTACGCAGTGGTTGTTACCGTGACAGATCATGCAGGCGCAGTTGCAGCAGCAAGCGTGTCTGTGACAGTGCTTGATGTGAATGAAACGCCATTCTT
TGCGCCAATGCAGCATTTTTTTATCCAAGAAAA