Description :
From Genome Similarity Track
Location :
scaffold_6:111595- 118389
Transcript NameFunction/comments
Pl_112781sporangia induced hypothetical protein
Pl_112782pyruvate dehydrogenase E1 alpha subunit
Pl_112783U4/U6.U5 tri-snRNP-associated protein, putative

Sequence
6794 bases(100 bases per row)
GCCTCAAAGGTCGGAGGATCTTCAGTCAAATAATCAACGAAAGCATGGAAACGATGTGATTGAGTCAATAGAGTGCGTGTGAAGATGCTCTGTTGCTAGG
CTGCCATCTTTGGCGCAGGGTCTACTATCCGCAAGACCACAGTCCTGGTCATGAGCGAACCATCGGCCGTGTCTATCGCTACTGCTGAAAACGGGCTGGA
ACAGCTCCGAAGACCAATCTGTCCAGCCAAGCAGGTCGCATTTGCGAGGCAGTACCTTCAGCTTGAGTCAGTGTCTCTTGCCTCCCGGCTGAACACACGC
AGTCAGATGCTTGGGCGCGTCGCTCCGAAGCGGCGATTCTGCCGAACGTCTTCCTCGTTTCCGCTGGTGAGTTCTCCTGCATTTCTTGTGAACGACGGCC
GCGAAACGATCGTCAAGCTTGGCTCCAAGCGCTGCATTCGTCAAGGGCAGAGCTCGACTATGGGCTGCATAGGCGCGCACTGCCATTCTCATGCGTCAAA
CGTCCACCTCGATGCAGTTACGCCACCTGACCTATCCTTCGAAAGTACGGGTCGTTATCCAAGGCGGCGGAACGTTGGGGTGAAGGTTTGCTGCCTCTTG
CACTGACCTGGAGCTCGTCGCTCGACGGCGGCGGTCGATTGAGGTGACCTGCGTCCAGCTCGAAATCAGCTCATGGCCGTCGTCGCCATAGACTGTCGCG
GCCGAGAGTTCTGGCTCAAACGCACGCAAATGCCGTCGTCGACGCCCAGCGCGTTGATCTCCAGCCACTTCCGACCATCTACGGGCACGTCAGCGACAAA
ATAGAAGCGGCCGTTCGAACTAATTCGAGGCCTGTTACGTGCGACGAGAAGCGGAGGCGCTCAGTTTCGCTTTTGAGCCTCCTCGCGAACGCCTCAGAGA
TCCGTGCCTAGCTAGCTCCTAGACGCTTAGGCAGTGCTCGATCTAATACACACACATTCACTATGGCAGACTCCAGCTCGTGCACCGGGTCGCCTCTGGC
CGGGACCCCATTGACTCCTCGCTCTCTTTCCAGCTTCGGCTCCTCGAACGCATCCGAAGTCAACGATGACAGCGAGAACGATCCCACTGAAGAAACGACC
GAGATGTGCGTCAAGGAGCGCGAACGCCTCACAACCGTGGCCAAGCGCATGACCGAGAGTCTCCTGGAAGCCACGGATCTGCTCGGTGGAATTCCGTGGA
CTCTGGTGCACGAAAAGCACGGCATTTCGCTCTTCCGGGCTGATGCTACCAACGCAGGAACTAACGTGCCTTGCAACGTCCACGCCGTGTGCAAGTTTGC
CTGCAATATCGAAGACGTCGCGGCGTCTCTCATCACACCGACAACGGCGTCGTTCAAGCGGATGATGGCCATGTTGTCGTCGGATTTCCTTGATGGTGCA
GTAGTGCAGAATATTGTGGATCCGACTCCAGCTAACCCGCACCGCTACGTCGCTCTCAAGTGGGCCGCCTTCAAGAGCTCAGGACCGTTCGCCAAGGATC
GCGATCTCCTCATGCTCGAGTATGTCGACATGATTGAGGACGCACAGGGACAGATGACCGCTTTCCGTGTCATGGAATCCGTGGACACCCCTGCTGGGTT
TTCCAAGTACGCCGAATCACCAAAGTACACGCGCGACCTCGTGCCGCTCATAGGTTTCATGTATCACTCAACGAAGCGATCAGGTGAACTACGCATGACT
TACACATGCAACTTTGACAAGAACGGCGACCTCCCTGCGTGGGTCGCCAACTCGGCCATCCAGTCACACGTGGAGAAGTGCATCAACGGCATTCTCAAGT
ACACAGAGAACTTCCGTGTTGGTCGTGAAGAGATTGTGCTTCCTCAACAAGTGATTCCCATGAGTGAGCAAGATCATTGCCGCATTTGCTCCAAGAAATT
CTGCGTGCGCCGCCGTCGCTACAACTGCCTCAAGTGTGGAGAAGTGTGTTGCAGTTCATGCAGCTCGGTACGTAGTGCACAGGTACCTGAAATCGGTGAG
CGTCAGCTTCGTGTCTGCACAGCGTGCGTTATTGAAGCTCGTCGATCCTCACGAAGCACAGCCAGCGGTGTTGAACCACCAAGCACTCCGTTCAGCTCTA
CGAGCACGAACCAATTCTTTACAGACACGAACGAGCGAAAGCCGCTGGGTCGTGCCCAGAGTTTTTCAGTTCCGAGAGGCGACGTAAAGCAAGAACCACC
GAAGCGAAGATCGTACGATAACCTTCTTGACCCTGTGCGTTCCCGTCTAATTGAGTACAAGACATTCTCATCTGGTTCGGAGGATGGTCTCGCTGCCACT
ACAGGCTCTATTATCGGTGTGCCCAAAACCAGCTTCCCGAGTCGTTCCTTCAGCGATGGTCTCGTGATGCGTAACAAGGCTCTGTTTGCTGCTAAGCGCC
GTGGGAGCCCAGCAGACTTGGCCATCTCGATCGAGGCCTTCCGTCTGCATCAAATGCGTATGGGCAACGCTGAACGACAACCTGAAGACGGCTCGGACGA
TAATACGGACGACGAGTCTACTGCGTCATCTTCGTCCATGTCACCAACGTACTCAATCACAAGGCCGTCACCTATGCATGAACGCATCTCACCCCACAGT
CTTCGCACTGCCCGCTCACGCATCCATATCAATCACGAGAGCAACCAAGATGCTCATTTATCTGCCGTAGACGACGAAAAGTTCGAGTTTAACGAGGCGA
TTGCTCGCGCTAACAACATTATCGTCGCTGCGAACTACGCGAACAGCTTGGCCCAACAAGCTCGAAAGCTCTCGCATTTTCGCGTTGTGGCACTGCAACA
AGAGCACGAAATTATGGCACCAATGCTTCGAAACGGAGGCAACAGCAGCAAAACCAACAATAGTCCAATGGTGCGTCGTCGACCCCGTCACCGCCGACAC
GGCAGCGATTTCGAAGCGGCACCTGGTGCTGGAGCTGTATTGTACTCCACCTAAATCGCTGTCCGCTCCAATGTGTTGGAAGAATTATGAAAACAAGTAC
CAGACGCACACGAAGCGACCGACCGTGAACTAGTTAGTAGTCAAGTAGTGTAGAAAAATTATGCGCGGCCGTCAGTAGTGCAGATGTGAGTCCATATGTG
GAAGAGAAGCATGTACACGCACGTGGAGCGGGGAACGAACAAGCCACGACGGAGTGAACTTGCATTATAAGTATCGTAGTAGGCTTCAACATGGAGATTG
AGCAGCTTTAATCCTTCATTCGTACTTCGACGCTTGATTGGTTAGCAACCGCAGCAACGAATAGGTCGAGGTCAACGTGGAGCTCCTCATAAAGACATGC
TCAAGTTCACCATGTCAGTTGATGAAGATGCCCATCTTCAATCCGTTTCTGCTGCTTGGTGTCAATGCGTGCGTTTGCTGCGCGCTGTTTGGCTCCCAGT
CGGATTTGCAGCATTGTGATACTGGTCAAGCTTTCGACGCCACACCCAACACAGCAGGACAGCAGGCAACCTATGCAGCTTTCACAGACTAATGTAGAAA
GACGATGCAGGATCAGTGATGCCAAGTTGGTGTCAGTCGGCGAAGGCTTTTCGGCAGCAAGACAAACGTGGTTGTTTGGGGCGTTTACATATTCAGCCGG
ATTAATGCTGTAGCAAAGCTTACGAGACTGTTCCTAGAGCTAAGCTTCGCTGCCAGCCTGGTTCTAATGCACTGCACAGCGCACCTAACACTGGCAGCAA
GCCAAATAAGGAGGAAATACAAAACGGCGTAGCGCAGCTTCTACCGCTTGACGAGGCGCTTTAGTCCTAAAGTGGGGTGATGATCCTCTCGCCGTTTTGT
ACACTCCTTCCTGTGCTGAGTTTACTGCTGGGGCTTGCCGTTGTACATGCTCTTAGCGTAGTCAGGGAAACGGATGAACGGCGGGTACTCATTGTTTCCC
TTGCCGTCCGTGTACACGTCCGTGAAAGCCGTAGACGCGTTGGGCTTGCCCGAGGCCTTCGCCTCCTTGGTGGCCTTGACAACTTCAGCGCGCACCTTCT
TCTCAAGCTCCTTAATCTCGTCAGCCGTAGCAAGTTCGGTCTCGATCATGCGCTTCTTCACGAGCTCAATGGGGTCACGCGTGGCACGCATCTGCGAGAT
CTCGTCACGGTTACGGTACGTCACACCAGGGTCAGACATGGAGTGACCGTGGTAGCGGTACGTGTTCATCTCCACGAAGATAGGACCGTTGCCCTCACCA
CACCACTGCTTCAGGAACTTGGTGCATTCACGCACAGCGAGAACGTCGTTACCGTCGCACTTGATACCGGGGATCTTGTTACCCATGGTGTAGTAGTCCG
TGTTGTTGGACGAACGTTGGATGGAGGTGCCCATGCCGTAGTGGTTGTTCTCAATGCAGAAGATGACGGGCAGCTTCCACAGAGCAGCCATGTTGGCAGC
CTCGAACACCTGGCCCTGGTTGGAAGCACCGTCACCGAACATGGTGATGGCGCACGGCATAAGGCCCTCGCCGTTGTGGTTGTACTTGCTGGCAAAGGCC
AGACCAGCGCCCACAGGCACCTGAGCACCGACGATACCCTGACCGCCGTAGAAGTTGGCTTCCTTCTTGTAAAAGTGCATGGATCCACCCTTACCGCCAG
TAGCGCCGTCCTTCATGCCGAAGAGCTCAGCCAAGACGTCCTTGACTGTGGCACCACGGGCGAGCATGATGCAGTGGTTACGGTACGACGTAATCCACGA
ATCCTTGCGATCCAGAGCAGCCTCCACACCGGTGGCCACAGCCTCCTGGCCATCATACAAGTGGCAGAAACCGCGGATATTGCGGGCCTTGTACTCGTTG
TCGTTGGTGATCTCCATACGGCGCATAGTATACATGAGCTCATAGTAGCCGAGCATTTCCTCGCGGTTGGTCACAGCGAACTCAGCCGGGCCCTGGTCAA
GACCTGCAATTACGGAAACGACATGACCATCACTCTGTGTCAGATATCAATTGTGAGGATCCTGTGGTAGCTGACGTACGGTGCAGCTCGAAGGGAGTGG
AGAACTCGAACTTGGCCTCGCCCGAGGCGTTCGCGGCGGCGCTGAAGGCGCGTGTGGCGGGCGTGGCATTGCGGGCCAGCGCGGCGGTAGAGCGGCGGAG
CATCATCATCTCGAAGGGGTCTGCGCTTCCTTTCTGCTTGGAGGATTGAGGAGTGAGCGTCCAAGCAGCGCCGCAAAACCGCGCAGAGCGGGGATTCGCT
TAAATGCGACCCCCCCCTCCTTCTCGACCAATGACGTCGCTTGAACAAATCATCCACATTGTGCACAGTGTCCCAGTATGGACACCTTCTCGAGATGATG
GATAAAGCGTCTGCCACGTGCTGCAGACTGTAAGCAGCGGTAACGATAGATACTCGAGGCACATCTAGGTAAATAGAACACGTATAGCGTCGTGTGGAGA
CTTCCAAGTAGTGCGGAGTCCATCTGAGCGCAATGCTTGTCGAGACGATGGGAAGATCAATTTGACTTGGGTTTTGTATGTGATCCGAATAGATGGCACT
TACGCACTTACTGCGCACTGATTGGAAGAAAGTTGGGTAGTTATCCATCACGCTTTTCATCCAATCCCACAAATGGGACTTGAAATCCTGGACAACACCA
CTCAAAGCGTCTCAATGGCAATTAGGATGCCCGCCACCAAGCGCAAGGCTGACACGGACGATGGCGCCGCCTCCAAGCGCCGCAAATGTCCGTACTTGGA
CACGATCAACCACCAACTGCTAGACTTTGACTTCGAGAAAGTGTGCTCTATCAGTCTGTCCGACCAGAACGTCTACGCGTGTTTAGTATGCGGCAAATAT
TTCAAAGGCCGCGGTCGCAACACTCATGCCTTCACGCACTCGGTACAGAGCAGCCACCACGTGTTCATTAACCTGCAGACGGACCGCATTTACTGCCTGC
CGGACAATTACGAGGTGGTGGACAATACGCTCAAGCCTGTGCAGGAAGCACTGCGTCCGTCGTTCGAGGCTGCGCAGATCGTTAAGCTGGACCAGAACCG
CATCTTGGCACAGGACGCTTTTGGAGTATCGTACTTGCCTGGATTCATTGGTCTTAACAATTTGAAGCACACGGACTACATTAATGTGGTGGTGCAGGCG
CTGGCCCATGTACCGCCACTGCGGGACTTCTTCTTGGGTAACAATATGGGTAAAGTCAAGTCCAAACTCGTACTGCGCTTTGGGGAACTATTGCGCAAGA
TGTGGAGCCCGCATAACTTTAAGAACACGGTGTGTAGTATAGTTCTGAAGTAGTGTGGTAAAATGCTGATTGTGTTTGATGTGTGATGAGTACAGATTAG
TCCGCATGAATTGGTGCAGGAGATCTCGGTGAGCAGCAAGAAGCGGTTCCACGTTGGAACGCAGAATGAGAGTGTGGAGTTACTCGCATGGTTGCTGAAT
GAGCTGCACAGGGTACGAAAAACGAGGGACAATGTTTGTGATAGATGCTGGAACTAACGATTTTGTTGTGGTAGGGACTGGGAGGTTCGCATAAACCTGG
GAGCAGTATCATCCACAAATGTTTTCAGGGTTTCGTAGAGGTGACGACTGATAATGAAACAAAAGCTGCGTCGGTGGACCCTGCAGAACGCGAATCGGCA
GTCTCTACTTCGGTGTCACCGTTCTTGTAAGTCGCTAGCTTATTGTCTATCCACGCTTGGCATTGATCGCGTTGTTGCATTTGTAGAATGATGGCGCTGG
ACTTACCGTCGACACCTCTATTCAAAGATTCTCAAGGTGGGAATATCATTCCACAGGTGCGTCTCAGAGCATTGTCTTTTGTTGCTGGGATTTG