Description :
From Genome Similarity Track
Location :
Scaffold_44:111541- 113171
Sequence
1630 bases(100 bases per row)
AGCGGCGGCGATCACACGCCTTCCAGGCTTGTCCTGGAAGAACTTTCTTCGGGACCTCAAGGCTGGCGACGTCGAGCAAGTATGCTTGGTCACCGAGGCA
GTCTCGGTGGATGAGGCGGCAAATGCGGTCGCAACGGACAGTGAACGTTCACGTCCGCTAGGTGCTGAACCTAAGTCTGCTCGAGAGGAACGATACCAAA
CGCAGTCTTGGGAGGCCTTGCGGGAGTCAGCGAATCCCGTTTACGACACCGCCTGCGAGTACGCCGACGTCTTCCCGGATGAGATCCCCGCCGAGCTACC
GGCGGATCGTGGGGTTCAGCATGAGATCGACCTCGCGCCAGGTACGAAGTACTGCGTCACCAGACAATGGCCACTTCCTCGTGATCAAGTGAAAGCGATC
GATGACTTCTTCGAGGGCCGCCGAAAGGCGGGTCACGTGCGTAAGATTACCTCTCCCCATTCCAGTCCAACGTTCTGTGTGAAGAAAGCTACAGGGGGGT
GGCGTATCGCTCACGCATTCAATAAGTTGAATGATGCCACCATCCCCGCGCAGACTCCGATCCCTCGGAAGGACATGGTACTGGACTCCATGGCTGGCAG
CGTCATCTACAGCGCCATCGACCTGACCGATGGATTCTATCAGATCCTGATGAGAACATCTGATGTGCCTCTCACCGCCGTAAGTACACCGAGCGGGATG
CTCTGGGAGTGGCTCGTGATGCCACAGGGCCTCAAGAAGGCGCCTGCCACCTTCAATCGCATGGTCTCCCATGTGCTTCGCCTACTTCGAGACTTCGCGC
CGAGTTACTTCGACGACATCTTCGTGCACAGCCGCGCTGAGGGCAACCTCAGTGCCGTGGACGTACATCTAAAACACCTGAGACAAGTCTTCCAGGTGAT
GCGAGAGAACAAGCTCTACGCAAACCTGAAGAAATGTGTCTTCTGCGCACCGGAGATTCCGGTGTTGGGATGCTACGTGAGCAAGAACGGTGTGCGCGCG
GATCCCGAGAAGGTATCGTCTATCTGTGCTTGGCCAACGCCGACAAGCCCCACTGAGTTGCGTCAGTGGCTTGGCATGGCCAATTACTTGCACAAGTACA
CAAAGAATTACGCTGGGTTGATCCAGCCGCTGTCCTCGCTGCTGAAGAAGGACGTGATCTGGGAGTGGAAATCGGACCACCAAGCTGCATTCGACTCGGT
GAAGAAGAGCTTGGCGTCTGCGCCGATACTGAAGCTTGCTGATGACTCAAAGCCATTCCACGTCGTCTGCGACGCGAGCGATTTTGCCATCGGCTGTGCG
CTGATGCAGTTCGATGATGACGAACACGAACGCGTTATCAGCTATCAGTCGCGCCAACTGAAGCCAGCTGAGAAGAATTACCCAGTCTACGACAAGGAGC
TCCTGGCAATGCGGTACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGTGAACAGTCATTTGCGGCTTACACTGATCACGCATCGCTGCGGACAGCGAT
GAAGAGCCCTCACTTGTCGCAACGGATGGCCGTTGGCTGTCATTCTTCTCCGAGTACCACTTCGTTGTTCACTACAAGCCGCGCAAGAATAACATTCTCG
CCGACGCGCTGTCTCGGCGTCCAGACTACG