Description :
From Genome Similarity Track
Location :
Scaffold_356:11152- 14358
Sequence
3206 bases(100 bases per row)
CGTGATAAGTATATGCCTGGGTATCGCGCTCGTGCGACTTATGCTCCTGGCCAGTTTTCGCCGTGGTCGTCTCGCTGCTTAGGTTTGGTCACGGTGGGTG
GAATGGATTTGGACTTCTTGTTCCGCCACACTCTCGTCCCAAGCACTACTTGTTCCCGTTTCGAAACCCCGCGCTCGCCCGCCTATCGAGTCCCAATGAT
CACCACGACTGGTAAACACGGCGCAAATCACCACTTTATACGGTCAGAGACCATGGGACATCCTGGATCGGCCGATGGCGCCTGTGTATTTTTCGCCCGA
CTGGCTGGTTTCAAGTCTTGGTGACTGACTATCATGATTTTAAAGATCATCACCGCCAGGTGCTATGGGAGTCCACCCATGTGCAACCAATCATCGTCGG
TCCAAGCCGCGCAAAGAATCCCGGGTTGAGCGTCTACTATGAAGAAAGGCGTCGTCGACGTTCCCGATCTAGTCCCCGGTGGAAGGCAGTGCTCCGGATC
GTGCTGCAGGGGTTGGTCGAGGGTCGGTGCAACCTCGACATCCTGTTAGACCCTTTCTTCCTGCAATTTTCCGGACGCTTGAAGAAATGCCTGTGACATC
CGAGTTTTGGCTGCCGACAAACCAACATCCCTAATTTGGCCTCCGCCTTGCGCCTGACGGACTCCGCCGGTCCCTGGCGTAATCAATACCGGACGGCCAT
CGCTGATCACCCGGGATCGTCCATCGACCGCCTCACAAACAAGTTCGTGGAGAAGTGATTGTCCGTTTCTGGTATAAAGGACCATGGTGTTTATGGCCGC
AGTCATGACCGCATGTCGTAACTACTCAATTCGCCTTTGTTGCTCGTTCCATTATCGTTACGTTCGTTAAACATGTGAATCCTCCCCTTTGCCAGCTCGC
ATGGTCATTGTTGCTTTCCGCTCACAAAGCAGACGATCACCATTCTTCGTGGTCGAGGTAAGCACCTCTGGTCGCCCTAACATCTGAATTTTCTTCGTTT
ACTTGCATCACTTCATACCGATTCCGATTAGCTCGATCACGTTCAAATTCCTGCAACAATGCACCACAGTTGAGGTTCGCTTCATCCACCCTGGTTTCCT
CCTTATGGCCCTTCCACCGGACCAGGAACTGTCAGTGTGTTCTTCCATACCGAGTTTCTCGCCCCGACTTCACATCTCTAATGCTGTCCACCTCTTATTC
CCCTTCGGCTAAATTGCCTTTCCAACTGTCCTCCGGCTTCATCAAAATCCACTCGCTCGGTTTCTTCCACCTCCAGCCGTGCAACAGGTTGGTCAGGAAA
ACTTCGTACCAATTTTAGCTTAGGTATGTGCACGAGCGGGAATAATCGGTATGGGTTTCCTTGCACTTCCAGCCGTACTGCATGTTCCCCAAACTTCTCG
ATCACCCGGAATGGGTCATGCCACATGTGAGCCAGCTTCCTGGCATATCCTTCTTTCACCCGATCCAAATACAGCCACACTTGGCTACCACAGCTTATTC
CATGTGGCCCTTGATCAGTGTTGTGTTGATCAGCCCGGTCCTGAATAGCTTCGTTCAGCCGGTCATTCACGGTGGCCCGGGCACGTTGGTACTGTCGCTG
TATCTGATAGCGCCATCTCCTGGGGTCACGATCACGTGTTTTGGTGCATCCCAACGGAAGGGTTGCTTCCAACGTCGATCGCGGGTCCCATCCGTGGATG
GGATAGAACGGGGTATCACTTCGGAATCGATCATGCGCCGTATTGATGGCGAAGGTCAATCGCTCGGCGTACTCATCCCAATCTTGTTGGTTCACGTCCG
TGACATATATCTTGAGCGCCCTGGTCAATGTTTGGATTATCCGTTCGGCGGTGCCATTGGCCTGAGGCCGATACGCCATTGTAGCACGCTGCTTTTGACC
GGCAATACGGTTGAATGCGCGAAAGAAATCCGACATGAACCCAGGTTCGAGATCATAGCGCATAGATTCGCTCGCCCCAAATCGCCGGAAGACGCATTCT
TCATACCCTTCCGCGGTCGTTTAGGCCGTCCTCGACGAGCTAGCCTTAGCGATCACGTAGCCGGAGACCAAATCAACCCAAAGAAGCAATTCAGTGTTTC
CTTTGAATGACCGGGGCAAAGAAGGGATATGATCCACTGCGATAATCTGGAACGGGTACGTAGCTTGCATGTTCCCCGGGGATTCTCCGCGTAGCGCCGG
ACATTCCTTCCCGGTTTCGCAGTCGACGCACTTCCCCACATACTGCCGCACGCTTCTGAACAAACCTCTTCAATGGAAGTGTGATCGCACACGGTGATAC
GTGCGGCCTACCCCTTGGTGACCACCTTCCAGAATTTTGTGGTAGTGGTGTAGAATATCATCTTGAAGCAGCTCCAGGATTACCAAACGAGCGAGCTCAG
CACGGTCATCGGGGTTTGTTGCCGATCGTCGGCAAAAATACAACAATCTGCCTTCATCTACAACGTAGTCTGGGGCAATCACGGCACTTGCTTTTGCTTC
TGTAGCACCCGGTTCCGTTACATCTCCGACTAAGTAAAGTTTGAGGTTAGCGATCCAACTCTCTTCGTCTTGCACATGTTTTATACGGTCGAGTCGCATC
TGCTGTACTACGTCATCGTGTATAATAATAAACGCCTCACGCCTTCGCATGATCGATCGTGTAATTGCCGCCACCTTGATCACTTGATCATTGCACGCTG
GAATCATAAATTCGTCCAGTCGATTTATGGCGCTCAGATCGTGGAGCTCCTGATCCGCTAGCATAAACATGCCCTTTTCCTGCTGTAAAGCAGTGCTAGC
CAGTCGATCCGCACTGATTCCATTCGCGCTTAACGTGTAAGAACTCATGTGTCGGCCACGACCTAAGTTGATATATGGATTTGAGGCGCAGTGATTGTAA
CCTTGATGCCTTGCAATCAATCTCGCCCCGCATCTGCCTGTTGGCCAGGTTGGAATCCCCACAGATGACCACTCGTCCCCTTGTCTGTTTCGCTAGCAGC
TCGCTACTCAGCAGTAACCCGTGCTACCCTGCCTCGTTCACTGTTAATCGAGTATCAAAACGCGACGCAGCTGACAATTTGGTCCACTCGGGCAATTTCC
ATATCACTGCACTGTAGGCGCCCCCTTTTTCTTTATACGTGCTGACCCGTCAGAGCTGAAGACCAACAGCACTTCGACATGTCTGACCGTAGGGCGTGGA
ATGTTA