Description :
From Genome Similarity Track
Location :
Scaffold_445:1115- 5355
Sequence
4240 bases(100 bases per row)
ACCAATCAGAATGAAGACGTGTTCGTCACAAACTCTCATTCTCAAAGTCGAAAACCATCGACTTGGCCGCGCGAGCGCGGCGGAGGCTCAGTTCACAGTT
AGAGCCTCGAGCAGCAACCTGTGCGCTCTTCGTCTAGGTCTCCACTTCGACCGTTATCATGCCTCGTGGCACTGCAAAGAGCGGTGCTAAGACACGCTCC
AAGGCTGCTGCCGGTAAGGCGCAAGCCAAGAGCACTAAGCCTCACGGCAAAGGCTCTGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGTT
CCTCGGGTGACGCGGCTGTGAACAAGCGCGCAAGCAAGCGCCGCAGCCCGTCGCCCTCATCTTCAGACCATCGTCCGAACCCTCGGTTCGTAGAACGTGA
GTTCAACTCGGGCAGTAAGGACGATGCGAGTCCGGGAGCACTCATGATGCTCCTGCGGGCTCTGTGGGAGGGCACAGCCCAGTGCCCAGTGAGCACAAAG
ATGACAGCGTGCAGTCGCTCGCTAGTGATCAAGGTGATCACAGTCCCACGACCTCTGTGCGCTCTGAGAGTCCGGCCGTCAAGGCTAAGGGCGCTCCCAA
GCCGGTGGCGATGAGGAAGAGAATCCTCGCAAACGTCTCTCGCTTGCCAAGGGACTTGCGCGTGCTAAGGCCTCAAAGGCCGAAGGTGCCAAGCCCTCAA
AGAAGCGTACGGCCTCTAAGTCTCCACTCCGCGAGGGAATGGAGACTATTCGACTCCTCAGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAGGAGGAGG
GTGCTATTTCGGAGCCCCGGGAGGTCACGAATGACCTCGACCAGCAGCAGGAGGAGTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGGCGGCACC
CGTCAGCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGC
CTTGTGGGCGGCCACACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAAAAAGAGCAGTTGTTCGTCGACAACTTGGAGGCTGCTCGGTGTGTGCTTC
TCGCGCCACACCGCATCCCCCTTAAGGACTTTACGACTTGTCGTAAGAAGCCCGAGAACCGGGGTGGGCTCTATCCTATCCCTGGGTTATGCCCGAGAGC
TGCCCCACCTGGCGTTCCTGTGAGGACATGTTCTGGGCATGGGTGGAGTCTCTCAAGTACTCACCCACGGAGTTACGGGAGCTCCATGAAGACTAGCTGC
TGTCTCGTATCCTGGACCAGCGTGATCTTCGTGTTCGGTTTGCCCACTTGGTCAGCAAGCGTATGCTGCCAAGGGACATCCTCAAGGGTGCGGCTTCCAG
CGCTCACGATGAGCGCGGGTACGGAGTGTATTCAACGTCCGTACCCCGTTCGGGCAAGAAGCCCTGGACTACTTATGAAGCTGCCGCCGCTTTTGTTCCC
AGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCG
CTTACCGCGACGCCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCTGGGGCGGAGGTGCCCTCGTATGAGTATGA
GTACTCGGCGCCTCCCGAACGCCCTTCTCATCCGAGTGCTCCGACTGCGGGTCCGACACAGGGCCCTGAGGCTGACCGCCTCCATCAACGTGTCCTCGTG
CTTGAGATTGCACTTGGCCTTGGGACTGGCGGTGATGCTGCCGCCCAGGCCGGGAATCAGGACGAGATCGCTTGTCTTGCGGGCCGCCTGGACCTGTTGG
AGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGATTGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTCTGTT
GCCACGTCCGGAGCCACCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCTCCGGGGTCCATTCG
TACGGAGCCCCTCCTGCGTACGGTCTTGACCGCAGTTTTGCCGTCCAGACCGAGGCTTGGGCGCCTGCTCCGACGCCCTCGTCGACGTCTGTGACCGGCC
CTCGCTTCGAGGAGCTGGGTCAAGGGGGGTCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTC
GTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCACTTTGTTGCTGCCGACAG
AGCTGACAGTGTCAAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCCCTAACCTCAAATATACTTAAGTTTCCTCTTCCTTGTTTGTCTGAGTACTC
CTTTTGTTTATCTTGGGCCGCTGTCATGACATCGCGGACCCTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACT
GGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATTGAGGAGCAAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGG
GGTGGCGGAAGCCGTTCAAGTAGAACGGTGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTTAACAACTGGAAGCTGCGTCGACTACGT
ACGTGGTGCTGCCGCGCACACACTGCGTAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGGTCCGCAGTGGACATC
TGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGTGGGTCTCGGTCCGAGACAATCGTCTCTGGGAGACCGTGATAGC
GGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTAACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACAC
CAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGCCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGT
GGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACTTGTATATGTGGGTCCACCAGAAGGACT
GAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTTGCCGCTGGAAGGCGCGTCATGTGCCTCCGCGAGGATGTCGAACTTCCGATCCTCGTCGTTGGG
TACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGC
CAGTCGGACTTCGCGCTCGTTCCGGCCATAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCG
CTGTCACCCGCGTGATGTGGGTCAGCTCATAGTCGGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTATATTCGACGCGGAAGTT
GTATTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAG
GGCCTAGAGCCCAGAAGGTGAACACGAAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGA
GCTGCCTGGACTGGAACGAGATGACTCGTTCGTGTCCAGCCGTGTCGGCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCT
AAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGTCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAG
TCGACGTCCTTCTGAAGGAGACTCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAA
GATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGC