Description :
From Genome Similarity Track
Location :
Scaffold_206:11147- 13734
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_206-snap-gene-0.16Small glutamine-rich tetratricopeptide repeat-containing protein B

Sequence
2587 bases(100 bases per row)
AGTTGATCTGTCGTGGCATCAGCCACTCCAcgTTGCTATCAGTaCtGTTTACAATACGATTGAGTCATCATTTCACGATCCGTCGTTGCGGGTGGATCTG
gaCGGACCACtGTACGATGGGTCTCTCGATCGATTGTTCAGCATCGCAGTGGTCCCTGTTCTCCCTTGTTTATCCGCACGTCTACCaGAAAACGTGCCGT
CCACTTTGCTCCGTATGCTGTTGCGCATCTCGTTGAGCTGGCTCGTGACGGATGACATGTTTCGCTGGATCACAGTCGACAAAAGCAGTGCCCACGCTGC
TTTGGTTCTCACCGTATCACGACTTGTCTCTAACTCCcAGGTGAGTATACAAGACGCCGAGCTCGCCTTGTCGACATTtCAAGTCGCAGTCCCACTTGCA
CAAGGCAATTCGAGGTACCAACTAAGAGAGTCGCTCATTGGCCCAATGGTCATCATCAACGCCGCGCTCTGGAAAAGCACTTTATCTGTCGCTAGCGACA
AACTACACACGATGGtCATGACCAACTTGGCCACGTTGGCTGCCTCAGAACACTCCATTAAAATCACCGAAGATCAACCAGTTGAGAAGAGTGATTGGGA
TGATTGGGATACCGAAGACGAGCGACCAAAAGTGACTGAACTCCgcTCCTCGACGTTCTCCTCCGATGGCGCACCGTCAATTGTAGCCACCACGCTCAAA
ACaTCTCTGTCTCCCCATGAAATTGAAGCATTGCGCGTGGCTCTACGCTCTACGGCAAGTAGTGCGTCATGTGGAAGTGATTTcATGCTCAATCTCGTCG
CTCAGCTTGCTACATTATGAGGAGCTACAGGAATGCAGCCATAGTGAAGGAGATACTACTATGTTTATACAGTTTgaTGGGATGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTCTATTATCCAActAAAAa
CtctATTAACCAAttGGAGAagTGTGAtcGGTTGAAAAGTAGAGCTCGGGTGCCAGAGGTCCTGGAATGTTCTGCCCCTTGACCCGTGTCAATCAGAGAA
GAAGAGGGACaGAACCACGCAAGGGAACCATGGACGCAGCGgCGAAGACGGCGCTGTTCAACGCGCTCGCGTGGATCGAGAGCAAGAAGGGCGACGCGAG
CGTAGACACGGAGAATCTTGAGGTCGGCGTGCAGTGCCTCACGTAAGTTGGGTCGTCAGGAGGCCGCAAACGAGACCGAGAAAGGTGATCATCGCCACTG
ACGCAAAACGTCATGTTCAGTGAGGCGTTCAAGCTCAACCTGCAaGACGCGCAGCAGAAAAGCCAGTACGAGTTGAACGGAACCGCGTCGTTCGTGGAGA
TCTTCAGCGCTGGTGTCGCGGCGCTGGGCCTGACGCCCAAGGGCGGCGAAGAGAGCGTGGAGAATGACCCAGCCATCACAAAGAGTGAGTTACTTACGAG
TGGCGTGTGATAGTGTATGTATGAGAACTGATCATGGCGTGCTGGTTGTGATAGACCCAGCGTTGTGGAAGAAGTGGGTCacGAaGCTCGAGGACAAGGG
CTTTTTCAACGGTGCCCCAGTCGACTCGGATGAGTACAAGTCCCGTATGAAGAAGGCGCTTGCCAAGTACAAGGAGCGCGTTGCCGACGCCAAGCCGGCT
GCGGTATGTGGATCgCAAGGAGATGCGTTTGCCTGGACGACTGATGGGTGTGGTGAATGTAGCCTGTGCTTTCGAAGGAGGAGAAGGAGAAaCTCGCGGA
AGAAGTCAAGtCCAAGGGCAATGCGGCCCTCAACAGCGGCGACTACACCACGGCCGCGAAGCTCTACACCGATGCTTTGCAGCACTCGTCTGATGGACCA
AACTCGCACATCTACTACGCCAACCTCGCGGCGGCGCTCATGTACCTCGGTCGCTACAGCGAAGTGATTGACAACTGCGAAAAGTCGATTGAGCTCAAGC
CATCGTACGTGAAGGCGTACTCCCGCATGGGCAATGCCCAGATCCACCTGAAGGACTACGAAGGAGCGATTGACTCGTTCCGCCGTG