Description :
From Genome Similarity Track
Location :
Scaffold_342:11145- 12500
Transcript NameFunction/comments
Phyag_g4838hypothetical protein PHYSODRAFT_537381

Sequence
1355 bases(100 bases per row)
GGGCGTGGacgacctggtgctgctgccgtccgTGAGCGAGACGTCCATCCTGGAGAACCTCAAGATGCGCCACGCCGCCGACGTCATCTACTCGTACATT
GGCCACGTTCTGGTGGTCGTCAACCCGTACAAGTGGCTGGACATCTACGGAGAGGACAGTATGCGTGCGTACATGCACAAGGCACGCATCGACGTGGCGC
CGCACGTGTTCGCCACGGCTGAAGAGACTTACCGTACAATGCTCAGTGAGGAAGACAACCAGTGCGTCATCATCAGTGGGGAGAGCGGCGCCGGCAAGAC
CGAAGCCTCCAAGCAGATCCAGAACTACATTGCAGGCGTCAGTGGCAGCGGTGCAGGCGTCGACAAGGTCAAACGCACTTTCCTAGAGAGCAATCCGCTG
CTCGAAGCCTTTGGCAACGCGAAAACGCTGCGTAACAACAACTCCAGTCGCTTCGGGAAatacttcgagctgctgttcgactCGGCAGGACGCCCGCAAG
GCGGCAAAGTGACCAATTACTTGCTGGAGAAGTCCCGAGTTGTTAAACCGGGAAAAGGAGAACGCAACTTCCATATCTTTTACCAGGTGTTGACGGGTTT
GCCACCTGCAGCGAAGCAGAAGCTGTACTTGGATCGAGGAGGGCCGGAGAGTTTCCATTATCTGAAAGTTAGTGGATGTTACGATGTTGATGATGTGAAC
GATGCTCAAGAGTTCGAAGAGACCATGGCGGCGATGCAGCATGTGGGGATTAAACGCAAGCAGATTGAGCTGGTGATTCAGACGCTGGCAGCGGTGCTGC
ATATTGGTAATGTGCACTTTCAGCCGGAGACGGTGGGCGACGCAGAGGGATCTTCGGTGCGCAACCGGGAAAGCTTGAAGATTGCATGTGAGTTGCTGGG
ACTTGATGCTGCGCGTGTGGAACACGCTCTGTGctacaagttgctgcagacgatgGCGCCTGGAGGCAAGATTGAGTCGTACGAAGTGCCGCAGAATATC
AGCCAAGCGAAAGCACAGCGCGACTCTATTGCAAAGGCGGTATACGACCGACTGTTTGATTTCTTGGTGGAGCGTGTGAACCATGCGCTGGATattgaga
agaaggctgaAAAGCATGGTGAGATTTTGGAGATTGACGATATGACCACGATTGGCATTTTGGACATCTACGGTTTTGAAATTTTCGACAAGAACGGATT
CGAGCAGTTCTGCATCAATTACGTGAacgaaaagctgcagcagattttcATTGAACTCACGCTGAAAAGCGAGCAGGAGGAATATGCACGCGAAGGTATC
GCATGGTCACCGATTCCGTTCTTTAACAACAAGGTCGTGTGCGATTTGATCGAAG