Description :
From Genome Similarity Track
Location :
Scaffold_7:1114455- 1122609
Sequence
8154 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCTGAATCCTCTG
TGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTTGTAAGATGGTAGGCATCTTTGGGACA
GATGCCCTGCGTAGCTTGGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTCAAG
GGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAACCTTCACTT
CTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCACCTTTGCGCTCTCCAACCTTAGTGGTCGCGCTAAG
AGTTGGGCGTATACGCGCGAAGCGACGACGCCTGAATGCTTCGCATCATGGTCCTAGCTGTGCGAGCAACTGCGGGCCGCGTTTCTTCCGGCGAACTACG
AGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGTGGG
GAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCACGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACTATG
GAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCAGTCATGGTATGGCAGAGCAACCCTGCCTCTGGCGGTGCGC
CTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCAGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCTGTGGCAAGCT
TGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGCGGTCGCTGGCAGAAGCCGCGCCCCAGG
AACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGACTT
AGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGAATC
TTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCAACG
GGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCC
GTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGAATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATCGGG
GCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAGCGT
CTAATCAGTTCTTGGGGTTCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACAAGGTGGGTAA
CGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGCGGGTAACCAAGTTCCACGCGAGGTC
ACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAGTCG
CTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAACAA
GGCGGGTAACCAAGTTCCGCTCAAGGACAAGACGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAA
GACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAG
AGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCTCGAGGTTTCAGAGTTGCTGAACCTTGA
GGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGACCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTTCACGTCGGCCGAGTTGAACTCG
TCCTCGATCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACC
CCTTGGTGAAGGAGTTCGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCACTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCAC
GAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAG
TCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGC
CTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGAT
CCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCG
GCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAG
GCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGCATTCGC
AGCTGAGGGGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGG
TCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCGCAAGTATAGTGCAGGCTACGCCTAGCTGGCACGGCCCTTGTCGGATCTCCTGA
AGAAGGATGTCGCCTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGA
GACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGTAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTC
CAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCAAGTGCACCTCC
TGGGCTCGACGCCCTTTGTCGTTTATACAGACCATGCGTCCTTGCGGACTGCCGTCAACACGTCGCATCGCTCACAGCGGATGGTGCGTTGGCTGTCATT
CTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATT
AGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTCGGCCGCTGGCTCGGAAG
CCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCC
CCGTATTGTCGTGCCCAACGACGTGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTAC
GCGTCTGTCTCGCAGTTGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTC
ACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACGGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGCCTCCCGGCCGATGCCCGTGGCAA
CACCGGTGTTGTTGCTTTTGCCGTCTGAGCAAGATGGTACACTTTGCTCCAGTTCGTGACTGGTGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTC
CTGCACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTTACCGCTGCGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGGCGGT
CGATGTCGACGGCGAACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGCCACGCTCCGCAGTATCTGCGCGGAGATGCCCCG
CTCTTGAGCTGATCGCTTGCCCATGGTTGAGTTCGCAGTCAACAATGCGGTACATGCATCGACGGGCTTTACACCCTTTTACCTGAACGGGTTGCGCCAC
CCTCAGGTGCCGCTCACATTACGAGGCAGTGCCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTC
CAGCCGCCTTGCGGAAGCAACTGTCCTCGTTTGTCGAAGCCAGGCTGAACATAATCAGCAGAGTGAGAGACATTTACCATGGCGCAAGCCCAAGATAAAC
AGAAGGAGTACTCTGACCAAATGGAAGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGC
TCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGTGGCGTACACCATAGAGTTGCCCAAGTCGATGA
CGACTCACCCGACGTTTTACATGGGTTGTCTTAAGAGGTACCATGACCATCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAG
CGCAGCTCCTCGAAGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTGCATCGGAGCAGCATACGCAGGGG
GCCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTTCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGA
GCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACG
GAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCTAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGA
AGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGTGAGGCCACCG
CCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGA
GGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCGCCAGGCAGACTGCCCGAAGGGTGTTGCGATATGGGACGAGAAGCAGCGGTAGCT
TCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTT
GCTTCAGCTCGTCCATCTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCG
ATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCTGGTCGTGTTGTCATTC
GGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTG
CTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGAT
AAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCACCTGAA
GAAGACTCGATGGCAGTCGTGGCAGTCGTGGCAGTCGGCTGCCTGGCATACACACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGA
TGGAGAGCTCCTTGGGCTTGTGGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGA
ACGCTTCTTCGCCTTGGCCTCGGCGGTCTTCGCAGCAGTAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCC
AGCACCTCATTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCGGCCACGACCCAAGCGTCGGCCATGGCGACTTCGTCGTGCGACGGCTTGCTGTCGC
CTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTAGTCATGTCGCCTGCCTCCAGCTCCGTGCCTTCGGC
AGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGA
GCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGAGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGC
TACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCG
CGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGC
TCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATCTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGA
TTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCC
TGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAAC
CTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACT
CCTGCTTCCTCTGTTATGAAGTGCTGTGTGCCCCGTCACAAATCTACTCCGATA