Description :
From Genome Similarity Track
Location :
scaffold_22:1114231- 1133618
Transcript NameFunction/comments
Plaha_PHALS_04678Acyl-CoA-binding protein
Plaha_PHALS_04679SNARE protein Syntaxin 18/UFE1
Plaha_PHALS_04680hypothetical protein
Plaha_PHALS_04681voltage-gated ion channel superfamily
Plaha_PHALS_15041hypothetical protein
Plaha_PHALS_04682RNA polymerase II assessory factor Cdc73p
Plaha_PHALS_04683hypothetical protein
Plaha_PHALS_04684hypothetical protein

Sequence
19387 bases(100 bases per row)
TTGGCAATAGCTGCTGTGCGCAACGCTTTGTTACATCTTGAAATGAGTTGTCCACTGCCTGGTTCTACGAACGTAAAGCGCTCAAAATGCGTTCAACCAT
GTGTGATGCTCTTTGCCACCTTTTCACGCAAACCTTGTCGGGGGAATATGGATATTGGAGGCTTATCAGCTCAACTCTTGATCCACATGCTCGTCACCAC
GTACATTCCAGCACAATTTGGCAATCTGATTGTGTTTGATAGACATGCCGTCTTGCCATTACCATCAAGCAATGAAAATGCCGCGTTCGCATGTCTTGAT
GTCGACTTGATTACACCAGTATACGTGGAACGCCCACTTGAACACGCTTTGAATCATCGAAGACCTCCATGTATCGTTTTAACAAGTAACGAATTGTGTT
CTGCAACACGTCAATTTCCATTAAACCGTCCTGAACAAAcgggagaagaagaaagtcATGGATTTCGAACGTTCTGGCTTTCAGATCCTTTACCTGTTAG
TGATATTGTATCCAGTGCTTATGTTGTACCTACAAATGCGATTTTATCACCGAATCTCGCATCTTTGAATCCAACGTTTACAACCCACGTGGATCGAAAG
TATCAGTTCTGTGTCCCTACTACGCGTGCGAATACGCCAGTTGAGTTTCTTCATTTACTATGGATCGGTCGGTCTAGTCGAAATCAGCCACAAACATTCA
CAACATTAAGCCGACAACAACCAGGTGAGTTCATGATCAAGGCGAATTCAAATGGTGCACTTGGGCCATGTGCGACTGTTGTATATCGTAGTTGGGCATA
TTTGCAAGATTCTCCGTTCGATGAATTTGTCACAGAAGACGGCATTGCCTATTGGTACGATCGGAAAACGGGTGATACATTCTGGACACGTCCTATACTA
CCAGCTGAAAAATTTCGCGGTAAAGACGGCGATATTGACGGTGTCGTGACAACTGGAGAAGGGGAAGTAGCCACACCTGGCACTGGACTTGTTACACCAC
AGTACTCACAAGAGAATTTACGAAAATACATTACGCAAAAAATGGAGGCTCCAGAAGAAATGATGCGACGTGTGAAATCGGTGTCAGCTAGTGCGAAAAA
GCACGAGATTGTCGTGGACATAATGCCTGCTGAGGCATCAAGTGTTGTTAAAAAGGGTGAGCTTCAACGTATCCAAGTACCACAACTTTCAATCAAACGA
GATAGTACTCGAGCAAGATCTGTGAATCGTTTGACAAAATCACAAGGTCGAATTGCTGGAGATTGTAGTGCTGAAACAAAAATTGCCGAGGAAACTGCAA
TGCCGTCACTGGATGAGAATACAAAGCAAATGATTGACAGTATCACTCAAGCCTTGGAATCAGCATTTCCGGCGTTGAATCAAGGATTGGGAGCTACGAA
GGGAGCGAATGTTGACATGCTGCAACTTGGGATTGGTCTTGGAATGGGCCTCGGTATGCGAGTTCAGCAACAAAACATATCTCCGTCAAAGTTGAGTGCT
GCACCTCGGCAACCTAGCCTCGTATTAAACCAAGCGGACGAAGACGAGCAAATTGAAGATTCTGAAAGGTCTGAGACGATCTCGGAAGTGTCGTCAAGAA
GTGCATGTTCAATAGCATCAATTGATATTTCTCCGACACCGGATCTTATCGAAGTAAGTGAAGGACCTCACGTTGGAAAAAAGACACCAGGATACATCAC
CCACGCTATGCCAGAAGTTAAGACATTGCAAGCCCGGAAGCCTGTAGATGAGCGGGATAAAAACACATTAGCTGTCGATCGTATTAATGGCACTTGTGAT
CAACGCCTTTCTAATAACTTTATGGCAGCTGTTAGCAGTACCAAAACGTGTCGAATGTACGCCAATTACTTACCGATTAGCAAGAATATAAATCAACCAA
AAAGTGTCGGCAGCGTGCGACCTCGTAAAGCCTTAGACGATTGGCTTCCAGTTGAATATTCTCCGTGGAGTGCAGGTCGATCGTTATTTGGGACTCAATT
TATTGACGATCTTATCTTTCGTCCAGAACTTGTCAGTGAACCTGAGATGATGAAACCTGTAACGACAAAGGTTACAGTACAACAGGCCAAAAAGACTGAC
GTTGTTTCGCAAGCTGCTAAGGAAAAAGAGCAACTTGATACTTTGTTCAGTCTTTGTCGGCACGGCAAATACGACGAAATTGAGTTGCTGTTGAATAGTC
CCGACTGGTCATCTGGCATTGATGTCACGGATGTTAATGGCAACACTTTACTTTCAATAGCTTGCCAGAACAACAATAAGCGAATTGCAAAGCTCTGTCT
GCGTCGTGGAGCTGATATTAACACACAGAACCTTAATGGTCAATCCTTACTCCATTATTGTCACGAATATGGCTTTCACGATCTCATGGAATATCTCCTG
GACAAGGGTGCACGAGACGATTTGCTGAACAAGGAAGGCTTGACGTGTTATGAAGGGCTTAGCCAGGAAGCTGTTGATGCGATTTAAACTGTTGATACAT
TAATTGATCACAAGAGTTTTGGTACCAATCAACCGGTTGTATATCGCAgtttgtatttaattgttgaaATAGTGCAATAGATGCAGGATAGTTGAAAAGC
CTGCGTAAAAGCAAAAGATTATAAAGCCGTAGCTCCTTCCAATGTTTTGCGTCTGCTCCAAAATGCGATTACTCTGAATGAATCAAAGGTTAAAGTAAGC
CAAACCGATAGTCTCAAGATGAATGACTCACCTGGGTGAGGTTGGACTTTGTCTCATGAGCGTGATGATGAATCAATTCAATATCAGTTTGTTGCTCCAG
GATCTTGCTAGCAAATTGACCCATTAAATTTGAAATTTCAGCCATCTTGGACTCCATTTTCCTGTTTCACataaatttagattttaaatAGTCGGAATGA
AAATCAAAAAAGCCCCACTTAGCATCCTCCAAGTTTTCTTGAAAGTGACGATGCAGCATAACATTTTCCACTCGAAATCGGCGCTCTTCCTCCTCTGAAA
ACTCAAGCTTATCATTTTGCGAGGTGAACACAAGTGATTGCTGCTGGATATCATCAAAGAAATAGAGAGCTTATCGAAAAGTCTGTCATCTACTTTATCT
TCGGAACGCACCGACAGATTTGGTGTTGGCCTTTGaatttttgaaattgagCGATGACTGATGTCTTGCTTCATTGGCTCTGCTTGTGGTGCAGCGTGAG
GCGTTATAGATTCTgtagctttgagctttgtCGGTGATTTTGGCTTTGAATGTGTCGGAGATTTTGCAGTTTGAGGTAAAGTAGCAGCATCTTGAATAAA
TTCTACCCTCTCAGGATTTGATTCTGAGATCTCTTTCTCTAGTGCATCGAGCTTCTGTCTATCGTCTTCAGATAATAAACTAAAGTATATTGCAGAAAGA
GTTACAAAGCACATCATTCAAATACAAAAATCACTAATTACCGTGATGACAGCAGAAACGGCTGCTGGAATCTTCTTTTCTGCATTTGTTTTGCACAATC
CGCGATGCTTTTTAATCGCTATAAGTATCATACAACAAAACTTTCATACTCATCTCTGGTAGCTCAATCAGTGCAATTTCACTCACCTCGAACAAATAGG
CAACCACTTCACTTCGATATGCTCCGACACTAGAAGCAACAGCTTCATTATAGCTTTTGGTCTCTGCTTCATTAAAATATTTCCAATAGCTCAAAGTACT
CACGTTGAGACTTTACCACCTCTTGAAGCTCGTCAATGCGGCAACTGCAACTCTTAATCAATTCGACCCAATCCTAAATATAATTGAAGCAGTATCAGGA
CCATATTTACAAAAGATTTCTCCTCTTTATCATAATGTTATTACTGCATCCAGCTCATCCTTGTCTTTCTCACTCATACGTGATTCTTTGATCCGAATAA
ACAAAGTCGGTAACAAATATTGAGGCCTTACGCGACGTAGCAAATTCTCAAGCTCCAGCAAGCTGCTAAGCTGCCAAAAATTACAACAGAAGTGTCAATA
AAGTGAAATTCGCCAATTTAGCGGCAAAGAGGTTCAAAATTTTACCAGATCCATCGCTTCTACTGTGAATGCGTCGGAATTTCTAGGAGGTTGAGGGCGT
GCTGGAGCCAGCTTGCGAAAACTCGCCGTAACATCAACACGCATCAGTTTGCACACCGCACGACAATTAGTCTGTTGGTATTTAATTCTAGCCAATGGAA
ATTCAGAAAGATATCGAAAAGTAAATCGTTGCAACAATGAGTATGAATAGACCGCGACAATGACAGTCACATCCTTCGATTAGATATACAGCACGCCTGC
GAGCGGCAGCATGTAACTGATGAAAGAGATAGCGTAATAGGGGTATGTATGTTTTTACAATTGGTacaatacaattgtacgagaATCAAGTTGCAACTGT
GATGAGAAAGTGAGCTCAGCTCTTCCTCCGCTGCTAGCTTTACCGATTATATGACCTCACTGTCGTGCGACTCTTGCATACGTacccaaacaaaaaattT
CGAAATCTACGGGCTTTTTCCTGGTGTAGTGAGAGTAGATTAACATTGCTGCTAACACATTAAACTACAATACTTCTCCCAGTGAATGCAACGCGAGATT
CATTGCCTCAGCAGTCCCATCGAACCGGTGAAAGAGAATCTGTAATATGAATTAGCATTTCAACCTGCAGCTCACAGCCCAGTTTTCTCGGTTCCGGACA
TCGATATCCGAAGTCTATTCAGTTCTTTCAGCTGCTCGCTCCGGGAGACCGTAGTATACAGAGCATCTCACCTCACTTGTCTTAAAGAACCTTTTCCGTG
AAATACGGTTGGTAATATCGGATCACCTAGGGACCGTGGCTTATGGCCACTTCCGCCTTTCTATCTTTAATCAGGCTTTTAGCGATTTCGTTGCGAATGT
CCCGGACGATCCAATGCCGTgcacaaaagctgcagcagggctgccgtagctttgccctttgaggaagcgtaaggtaggtcaccaacctatacttaaaaca
agtacgagtttagcggatcgcaatccgctaactccaagagtaattattgccttatcccaaggctaattaacttctccgtttaaatccagaaatgacttta
tttatttctatCTGCGACAAAGCCAccttattttaaatgcatagatttttctaaatatatagtaatcCTAAattcatgcataactactggctacccagca
aCGTAGCGTATCCTTATGTGGGTGCAGTcataccatgcccatctcgtgtgacacacacacctgttaccagggtaagcgtaaccccgttacaaaagcTGTT
GCAATTCGCGTGCCCCTACTTCTTGAACAGGTAGATCATAAGTCATAAAAGCTCAATTTGGAAGAATGTGGAGGGAATACTGCGTAATTCTAACTATTTT
CGTCTTACAGCTGATCCATAGCTCATGACGCACAAGTAGGATCAAACCTTAGATTCAAATGTTTCTCCATATAAACACTTTTCGCCCATAGAGATACGCT
GGGGGCACAGGGCAGTCTACTGAGAAAACAGAGCTATCTACTACTTCTCGCAAGAGCATTTTCTTGCTAGCTACCTCTTGGACTGCTTATTGTGCTTTCC
CCACGGTGTCAACTCAAGAAAGAAACATGTCAAGCTTGTCCATTCCAACCGTCAACAAATCATGTTACGTTCTCTTTTCATAAAAAATTCaagagaaaag
aagagaagaatttATTTTACTTAGTCGTTGGATTCACGACAAGGGCGACGGAATTGTGGTTAAAGATAGGGATCACCGGTCACCACAAACGTTTCAGACT
AAGATCTTCTCAGGAACCTAGTGCGTACACTTGATCAAGTAAAAAAAACTGATTTAATAAGCTCATCATTAATAATGATACTAGACATTTATCGGCTATG
AAAATCTAATTAGCGCGTTTCTTTAGGATAGCAGCTCATGTGGCATATGGATCTTTCTCTTTTCACTGTGCGCATTAATcagcatacttcatcatcaCAC
TTGACCGCGATAACTTTGAGCTTTACTCTGAGTCCGCGGGACAACAGGGTAATGTGCCCGTAAATCATAGTAAAGAAGGTATCCTACTAGACTTATCACC
CCCGAATCCGACAAAACAAAGCTGGTTGTGGTCATTGTGGAGACCTTAAACCGTGGAGAACACCTTACGCTAGTGTTTTATTGCTTTTGAACAAAGAACC
AAGCTCAAAAACTCAAGTATGGTATTACGATGAAGTATCATGATAAGTACTGGGACAGCTTGAGCGGTAGGTATTATAGAaaaagacctcttcaaatCAC
GTAGGCTGCTGACTTCACGATATGATTATAACCACAAAAAGATATAACTACACTTGCGCTTATGACAGGAAATCATTTGGCCCAAGAATCTGCATTTATG
ACGCACAACGCTGGGTTCGTACGCTTCGCCGGAAGCTAGTGTTACTGTGTGTGTAATGTCATCAGTTGCATATGTATAGATTAATTTTATCAAGTCATTC
ACTTTATTTAATAGATAGGAGCTTTACTGCTTGACGTATGGCTCATTGTCCAGGTGCCACGGGCCCGTACTATACTTATTCCCATCTCCCAAATTTTCAC
GAATTCCAACATATAATCTGGATTTTGTGAATTTGTGCAATATTGCATCGTACACAATCGCAAATATGTGCTATGCGTACAGGATGTGGACCACACTGGC
GCTGATATTTATCGTGATTCATGGGACATAACACGATAGTAAACACTAAACAAGCACTTCTGCGCATGAAGTCCCTCAACTCTCCTAGTAAATTATAATA
CCTGGTTTTCTTAAACTACTCGCAGCGTAAGCCTCTACCTTCACTACCCACATATTACTTAAGGGGCCCTTGAAAAACGAAACTCTCGCGTCCAAAATCT
TCGGTCATTCTCAGGGAAAGGCGTAGGTGTTCTTCGCCGATAACAGTCGTGGGAATACTTCAATTTCAACCCAGACACTTCTGCCTTCACCGAGATACAT
TCGACAGAGACGTTGATTAAGAAAGGAGTTCACATCGCTTTGCCTCGGATCTGgacaaaaaatgcatttcGTTATCGCTTTACGGCGAAAGATGTTGTGA
CACTCGCTGCAAAACCTTACAACAACGTTCTGCCGGTCATCCGCCAGCTCAACAATCGTACTGATTATTGCATGATCGATCACGCCGTGATTTCAATAAA
ATCCAACTGACGCGCCTCGCCGCACCGTGTCGCGGCCGTCGCACGCTAATATAAATGCATAGCGAATACTTCAAAGTCTCCACGCAAGCGTTTTTTTTAC
CCCACATGTCACAAGACCACAGAAATACAGCCTGTACTTGGAGCAGCAGCGATTTTGTACACCTATACCCTCCGTGAGAATGTTACTATCACTTACTGAG
CGCTGGCAAAAGTACCAAAGAGTATCGCGCTCCATTCGCGCTTCGGTCGAAAAAGACACGTCACTTCAACCAACTTGCTGCTATACAAGCCAGCTTCGTG
AGAGCATATATAGGGCAAGAACGTCGTAAGGTACTTAGATTTCGATATCCGAAACACGATGTTGAAATGTGGACTACCGTTTCCACAAGTTCTTGATGTT
AACAGCCCCGCTTATAACCGTGATTCAGCTTTTACAGCTATCGACTAAACTCGAACTTAAGATAAGGTCTGATCACATAAGGTAGTAGGAAACTCCTTGC
GTTTGATGATCTCGAcacaatttttaaaattcCATTCCATTTTATTCCATGTTACAAATATCATGACTTGGTCACCACGCGTGCTGCCACTGGATCGAGA
AGTTTAATGGATTTGGCTTGGTCTCTGAACCCGAATTCATCATTAGCGGCAATGCTCTTTAACAAAGGATAGCGACGTATTTGTCGATGCATATCACGAA
ATGGTTGCGAGGTAAATAATGAATCTTCACACTTTGTACTGTTTTAGTCAAAAAGGCTAACGATACGTGGCGAATTGTGCATAATTTTAAAAAGCTAAAA
GCAGTTTTAGTTCCGGTGCAAACACCGATTTTTTGAAAGGATGCGCCTCAGAACAGTATGGGCGGCTGGACTTTGCTCGGTGCCTTGATCTAAAATGGTG
TTCAACATCAATTTCTCATGATAGATGATGATATCCAGTGAAACTCCTCTCATTGCGACAAAGCCCCAAGCGCAATTCTGTGAAAGTGGCTAATTATGAC
ACAGAGACTATCTGATACACCAGCTACAACAAAAAAATGACGACGCCGCTGTTCAGGCCACAATGTTGCAATTGCTTGACAATATTTTGCTCGTTGTCCG
GGATATTACGGGGAATTAAACGTGAAGTATCACGTTTAAGGTTTGAGAATAGCTTGAGGGCATGCACTGAAATAACAATTGTCAGCGTAGCGATGTGTAT
ACTTTGCGCTTCGGTTTTTTATATGTAGCACGAAGGCCATTGTTGCTTGGCCAGTGGCTCCGATTTACCAAAAGAAATGGCTTGACAAAGCAAACTACGT
GTATAAATTTTACCAACAATTCACACTACTTGTCTTAAACAGCATATCAAATGGTGCTGGAACGTGGCAAAATTGGTTCAATCCAAAGCCGAGAAAGAAA
AACTCATGCAAGTCTTACAAATGTCATTTCATGCCGTCCGTGACGATTAAGACCTTGGCATAGGCTGTTCTCCACATCAAGCAGATGTCGATGGACGTGA
AAGCGAAATTGCGCTTGAATATCGCCAGCTTACAACTGCAGAGCGATACGTTTGAGTTCATGACAACGATAAGTACGCTCCAGTCAACCTCAGAGCGCAC
CTGCTTTTCTCGAAACTGTTTGATCTGTGCAAATAATGTTTGCCGGCGACGAAGTCTAACATCTCTCACCAAAATTCCAAGATGGTGATTTCATCTTTCG
GGTATTACTTCGGTAGAAATCTAGTCGAACCAATGTGTTCGCGGGTGTGTTTGCGTGTTTCGATTATGAGCTATCGCATATCAAGATGGGGACGCTTATA
TTTGCAAGATAACGTACGACGTCGAAGTTGCCAAAAATGGAAAGGTTGGCTAAAATTGAGAGATGTCGCATTTTATAAATGAGCTTATAATTAAAACGCT
CGCAGATCACTCCATCAGAGAAGGTAGATAGTGAAATCTTAGAAAGATAAAAGCCAAGGGTGCTCCCAGTCATAAATTTCAATGGCATCAGCGCAACCTT
GGCGAATTGAAATCTTTACTTCTGAGGACGTGTTGGAGTTATTACATCGTTTCACTTTGCCAAGGAGCTCGATATATCCCTTGTGAGCTTTCTGGTCCAC
TAATTTTCCCTGTAAAACGTGACCAAACATATCCCATCGAGCAGTGCTTGTAGAGAACGGCATTTTCGCGGCTGGTTCCCGTAAAATTTATGGCTACTTT
GACACTTTCTGAGGGTCCTGGTGTGCGTTTAATACTGGAATGAGCAAATTCTTGGACGCGCTCTCTGGGCTTCGCCATGACTGGCATTTCCAATGGTTCA
GAACTCCATTGATGCTATAGTGGTGAGTACACTCAGCCGCAATGGATGAAGAGGCTGTAAGAACGCTTTACACCCGACTTCTTTGAATGATTTGAATTAT
GGTTTTGCTTTTGGAAGCCTACGCAGATTACAGGATGTGTTCGTTCTCTTCGGGTTATTAAATATAAAACTAACGTCATTTCTGAGACGATGCAGCGTGG
TCGCACATTAGACTTACTAATCGCAGATACATCATGTTTGAGTAGGTTTAAATCGTTTACAAAGCTTTACCCCTCACCCTGTATTCACAAGTAGTTTGTT
TACCTGGTATTGGCATGTTGTTGTTACATATATTGGCTCTTATTAATAGCATCGGTGCTTGACGCTCAACCCCATTGAGACAAAATCTGTGATGTTGCTA
CGAAGCGCAGCTGGGCTGACAGCGAGTCGAATTGAAAGTCCAGCCCTCCCTTACCAAGATTGAAGCTACCTAATGGCGGTGTAGGAATGAATCAGATCAT
TTACATAGTTGAGGTCAAGTCAATACCGGTAGACTACAAATTCTTTTTACTACATTTATTGCAATTTAAACGAGAGGTGATAATAAGCTTTAGCACCATG
GTCTCTCCCCGCATGTAACTCGGAGGATATTCTTCAACACGCAATAACAGCACTTTGTCTGACCATCTGTCTGCGAATGACCAGTGATTACAATATTTAA
CCTAGTGTATGGCGCCTTAAACAAAGCTCGTCTGTAAATCGCTGATCTCAATCCTGTACAATAGCACCGGAAAACTGTTGGAGAAAACTCTGTCACGAAA
TAGCCTGACTATATCTTTAGGAAAAAAGGTGTTAGAATAAGACATCTTGCTGAGATAGTCGACAAAGACCGCGCTgccaaatgtttttttttaaacaaga
aaaatcatgaGCGTGTTGGCTGCCAACACTCTGCCGGGACTGACACGCTGGTCAAGAAGCCGCAGCCTGCGGCGATATCAAAGCCGTCGAGACGGAACAC
ACGGGAGCAAATATGTGCTTGCACATCTCGAGCCACAAATTTACAGCGCACACCATTCAGTTTTTCTACTTTATCAAGCTAGGCATACTTATACACCTCG
TACAATATTTCGTACGTGAGGTCCTCACGATTAGGCACCACCAAATATCGAGTCAGTGCTATCGACACAGCAAACCATGTACTAATAGCGACGCACTCCC
GAGCCCTTCGATAAAGCGGCATCTGATTTCGTAAGCTTCGTGCCTTTTAAAGATTTAGCACCGGTCGGGACCAGCCATGCACTTACTATCAATATGGCGG
ATGGCCGCTATCTATTGATAATAGAATTCCTTAAAGTATTGTCAAAGCGATTTTTTTTGCAGGAGTACCATAAAACTGAGTACCGGTCATGTCATGACAC
ATTAAAGTTCGAAAAACAACTGTATAACATGTGACTTAGTGTAGATCACATCAAATTCAACTTTCGTTTACGAAACATGTTGATATTTAAATTACCTGCT
AGATACTACTTTTCCGTGAGCTGCCGATAACCTTTCCACCACAAAGGAGCCAAAAATTCACCATCTTCTTTCCAACCCTCTGTCTCTATGACTTTAAGCA
CAACTTTAGTTGGTCCATCTTCCCACAACTGATTCGCAGCATTGAGTTTTACCCTTGCAATGTCCCATTTGCCAGCAAAGTACGCATCGATTCCTTCATG
AAAATTCGAAAAAAACATAGAAGGAATACCTTCCTGAAGAGCAGGATAGATAGTGTCGACACCATACTCGACGGGCTTTTGCCTTCCCTCCTCACTAACG
TCTGGCTGAACACCTTCTGATGGATACCGCCCGATATCAAAAGTCCACAAATCCATTGGTATTTCACTGCCCTTGACCGCTACTCGGTCAATTTTTCGAC
AAAATCGACGAGCTTCAGCAGACAATTCGTCAACAAACCATTCCGAAATTAGCATCGGGACATCAAATTGGCCTGTAGCTGCTTCGAGACGAGCTGCCAT
GTTGACATTTGGGGATAAATAAGATGCATCAATCTTAAATCTCGAGCCAATAGCGCCTTCGATAGCCCAGCCGATATGCAATCCAAAACCCAAGTGTACC
TCAAAACTGTCAAAAGCAGCAAGAAGCTTCGTGTTCATGCAGTATTTGTGCAGTGTACCATGATGATTGGCATTATGGATATCGACTCGCATCTTAAGAA
TCGCGGTCAAGGCGCTGTCAACAAGTTCCGTCGGTCCAATTCGTCGCATAATTGAGCCTGATCCTAGACTTTTGATATTAATTCCTTCACGTCGTCGAGC
CTTTTCAGCCGGCAACATGCGAGGCTTCTCAGCAGAATCTCGTGGGTCACGCATTCCTGGCAATGCTCCATCGCAGATTTTCCACGCTAATAGAAATGCT
GAGCCAATGTTCTTATTGGCAGCACCATGAAATATCTTGGCATCACCGTGTACAATCTCCGCAATTGTGTTGATGTACGTGATCACATCCTCCTCTAAAA
TGCTACACGTTTCAGTGAAGTGTTCAATGATGCCAAACCCAAAAACAGACGTAATTTTTTTGCCCGGTATCATAACATCAAAATCACCTGCACCTCCCAT
GTTTTTGGCTATAATCTCAGTACCGGCAGCACCAAATCCGACTTGTAATAACCGACCGATCTTACTAAGCGTGTCTTCTAGCATCTTGGTTTCGTAGTCT
GTACCATTTAGCTCATCTGTTTCATATTCCTCGCGCTTGGCTTCAGTAGATCCAAGGGGGTTTTGCGCGAGCTGCGTTACAAGACGCATCATCCGCTCGA
TTGGACCAATAACCATCGTCTCGGCATCTCTCGTTAGCACAAAGATGGAAACAGCAAAACATATCATCACAATAATTGTTTTACCGATGTTAAGATTTGC
TGCATTCGTTGTAAACGACGATATGTCAAATGTGACAGCTGAATGGCAAGAACTAATGCTACGAAGAGAATCGCAATCGATACAAACGTCACCGACATAA
CACCCTAAATTTTCCACGGTTGTAATCTCTGTGTTTCGATACTTCACGCTAGGAACGTCTAATAAATACGAGGCTGACCACCCTGTTTTCGGatttgtcg
tcaaagttTGGTTAGAACCAAAGAGCCAATCACTACCGTCGCTATTAAGCGGTTGAAATCTAACAGACTGAAGCCAGGACTTCAGCTGCTCACTGTCAAT
ACTAGCTAATTCCATCTGCACAATAAGTCCGTTCGCATCACGAACGTACTCGTCGACAAGACTTTGTATGTGTGCCAAAGTGACTGATCCAGATTTTTTA
TAGTCTTGAGTGTAGCGATGCAGACGCTCGAATTGAGACGTCTGAAAATCATCCTGCGTTAGGTCCACTGTTCCGTCAATTATTGGAGAGACGATAATAA
TGAGAAGCACAAGCACAATCAGCCTTCTCGTCGTCTTCTCCGTCAGCACTTTGCCAATTTTGGAAGGCTCGGAAATCTCAACTTTTTTAGTTTCGCCATT
TTTATTCTTCCTAACAACACGCATGATACGCAGCATGCGAAACAATCGAACTAGTCGCACTATTCGACCTGCTTTTGTTCCTGCACGTGATGCTCGACCT
GCTTTTAATGCAGCAGCTTGCGATGCACTAGTTGATGTAGACGAACCGACGACTTTGGTCCAAATCCAGTCAACGTCAGGAATCACGGAAAGTGTGGAAA
TTAGATCCATATAAAACGAAAAGCCTTGTCCACGGTTAAAATAGTTGGGACGACTATACACATTGAGACCCAGCtcaatgaagaagaagagaaagagtGC
AAAGAGAACGTTGTACACATGATCATCAGCATTTTTCGGAAATAAACTTATGCGCAAGTCGTCACCAAACAGCGCAAAAATCGTGCATGCTGTCATAAAG
GAGCTTACATACTTGTTCTCAACAAAAGCCAATACCTTCTGCGGTCGCGTCAATGGCGCAGGAGGTACTACATTCTCTGGTGCCACTTTATTCAAATTTC
GACCGGTTGAGAAATGTGATAGCGTCATTCCATGTTTCAAAACGCGTTTAGGTCCAAGACTATCATTTCTGTCTACTTCAGTAGAGATTCCGCCCAGTTG
CTTTACGGGGATCCCCCGCTGGTTGCACGACAAGGGATCCGGCATCTGCGGTCCAACACGCTTAAGTTGGCCCACTATTTGCTCTCCTTCGCCCGTTGTT
GCCACCACCACCGAACTCTTCCTCGAGTATCCTTTTGCAGTATTGTAGCGCCACCTTCGCTGTAACGCCGTGCTGCGTACGGAGATGCGTTCGTCCTGGC
AAGAGGTCGAACTTCAGATCGGCGAAATAAACAATTCCAGTCTCAGTAAAAATCTTCGTTCGTGATGGTAGTGACTGTAAACGAAGACGCAAGCAGAATG
GCTGTTCTTGTAGCAAAAATCGTGACGCAAGGAAAATTACCGAAGCTGCAACTACAAGCACCAAAATACTCCAGCACGTCGCAATCTCATCTCGAATTAG
AGCTTTGGTGGAAAACCAACGTATTAGCAATGAAACTGCTGCAGGTAGTAAAGCGGCGACTATTTTGAGAATTCAGAAACAAGAGTCAAAGTCACAATGA
ATCTGACTTCAATaacatgtgacatgatgATTAGAATTGCTCTATTCGGAAGTATTCATCACTCGCGTCAAGAAACTGGCCTAAAGAAATATTTCAACAT
TAGTGTAATCGAAGTTAAGTTTGAGAATCCAACGCTCGTGAGCTGCCAATTCATTTTGTTTCTTCTGCGTCAACGATGCGAAGTATGGCTCTAGCACAGC
GCCGAACAGCATCTAGTGGAAATGCGAAATACGATCGCAGTGTGAATTCTCATTGCAATTTATGCTTAATAAATGCAAACATGTAACGCCAAAATTCTTT
GGCGGCCACCTTGTCCAAGTGGCGTTTATCCGGATGAATCTAACAGACATCGAATATCGGAAATTATATTTAAAGTTAAACGAACAGCATGAATTTACGT
ACCATAAGCACCTTGACATCCCACTGCTTTATCTCAGAATTAAGCTGAGATCCTTGATTATAAATGTGAACTCCACACACTAATACCAGAGCAAGTAAGA
GCACGAAGCGAAGGTCATACATTTTAAAATCCATACCTTTTTTAAACACTTCAAGCGGAAATTTCCACTTCCAGCCCTTAAACTGCCAAGCCTGTCCCGA
CACGATTACACCAACAACCGAGCGCCTAAATTGCAAAAAATTAATACGTTGTTCAACGCTACAAACCAATTTCGTAAACATACCAGTCTTTGTCTTTAAA
TCGATTGACTGTGTCAACAATCTTAAAAGTATACATATGTCCATCCTCTTCATGCGAAATCATCATCGATTGTTCTTTACGGTGTCCGTCTGCCTTTTTT
TGCATGTTCGAGATATATACTCCGTCCACTAGAAAGTCTCGAGCATTTAACATCGTAAACAAGTCGGAGAATCCAGCGGGTACCACAATAATTGGAGTAC
CCGAAATCCTCTCTTTTACAAGTCGATGGAGCGGCAATTGCTCCTTTTTTGTTGTCGTTGTTGCCATTAATGCTGTCGCTTTACTGGCCTTTTCAATCTT
TTCCTTCGTCTCGGCATTCACGAGCTCAAGTGTCTTGATAACGCTATCAAATTTGGTCTTCTGTGCGTCCAATACCGTCGTGCGGGTCCTATTGACGTAT
TCTCGATCCAAGATCTTTTTCATCCGGTCATCGTCACCTTCCTGAACTTTGTGGTTCTCACCAAGTTTACGGCGATTATTCTCCTCCTGAAccaattttt
tcttttttgccgCTCGAGCTTCACTTTCATTTTCTCTTAATTTCTTCGCTGCTGTTTTTTGGTCCTTTTCGCTCGACGTAGTTGAGTGTTTTCCACGGGC
ATCCAGGATTTGAGGACTGCTGTCAATGTCTCCCTTTAAAAAAGCTACAAGTTCTTTCTTATCAACAGTTGAAACCATTGCTGCCTTTTCCTCTCGACAC
TTGAGTACATAATCACTAAAAGATAAGTCTGCGTGTTTAAAACACGTGTGAACAGCTAGCAGATCATAGCTTTTGTCGAGCTTCTTTGAGTGATATGCTG
TAGGCGCATGCTTTTGCAAACGTCGTAGCTCGGATCCAGAAGCATCAAGAAATACCAATTCTTCACCTTCAACTTTCACAGACTTGCCACCAATCAAATG
TGCACGCAACGCACGCAGCACCGCTAAAGGCGTGTCATCCTTCGTCGCCATACTATATCTAGTGTTGTGTGGTGAACACGAAAACAATCATGTGGTTGAC
ATGAAAGAGTCAAAACATAATTCTTTCGATGGCTAAACCGCATGTGGTGCTGTACTTTGATGTGAACAAGGTCTTAAAGCCTTCTCATTGGTTTCGTGCA
AAGACCTTCGACTAATTTTGCTTCATTTTAATGTGTACAGACGATTATTATGCACGATCCTATGCAGGGAAAGTCGCTCCATCATGTCCTCAACGACCTC
TTGACAGAACGAGCTTTGGGGCGAGTACTGAATGAGTCGAATGCCGATCCAAAGTGGGTTTGGAATGGAGAACGGATTTTGGAAAGAAAATTGCCAATTC
AAAAAGACGACGATGGTCTGATGTCCTACGGGGAATTTTTAAGAGCAAAGGTGGGCTAGTAGAGCCTTTGACAATCATTCGAAAAGTTGACATTAGTTAG
TATGCTGAACTTGTAGTATCCTTTATCAGACAATCCTGAGACtgccaaaaaaaataaagacaCGAGGAGGACGTTACGTCTAGAATTCACGAGCGAAGGA
AATCCGGGTGAAGGGCTGGAAATTGAGCATGAGAAATTATTGCAACACCTGCTTCTACCTCGTACAGAAGCGAGTGATGCCCATTTGCACGAGTTAGGCC
TGAGCGGATCGCCATATTTCTTTATTGTACCAGCATTCTTTCGGCTACTGGAATATTTGCAAACAAATGATTTTATCTTTAACATCATTTTCAGGACTTT
TGGTGACGACTTACGTCGAGTGGCGCAAGAgtttaattgtttttgcGAAGGACGCCATCCTTACTTTCCGTTAATGAAGCCTATGGATGGATCGGATGGA
AGTGTTGATCGACGTATATATCTTGATGGAAACCTGGATGGAAACATGCCACGTTTTGGAACCTTTTTGCGAACGAGATGTACCACAGCTTTGATCATGG
GTTCATTCGAGCAACCTGAAGCGACTATTGCCGACCCGCTAGCCTTCTACACTTCTCAAAACAATCATGTCAAGATTATGCAAGGAATACTTCAGATTCA
CCATTTTCTTGTGCGACGCTGGCGAAATTCGCAAGCCACGCTAGCTTTGCGTGACTACTATCCGTACTGGTTTAGTAATGGTGAAGTTGCTACTGCGGGA
AAGCTACTACTAGTTGATCGGGCCGATTCCACTGAAGGTATCCACGCAATGTTCTTTGACGACAATATACTgcttcatgacgcacatatCGTTGACGTTA
GGGATGCACACAATGGAGCAGCACAACCTTTTGAAGAGACGCGTGAGTTGCACTTGATGCGCGTCGAACCACTTGACGTGATCCAGAACACAACTTACTT
TATTGATCGCTTTAATGCTTCCTTACAACGAGCAATGAATGAATAAGGCATCACAACGGACAAAGATTTAAGATTTAAAGCACTAGATATTATTACAGTT
CAAAGCAAATGAGCCGATACCATACTAGTACTATTCCAATAACAACAAAACTAGCCATGTCTGCAATCCTATCATTATATCTAACAAATCGCGGCGAGAA
AAGTTTATCACATGTTTGCTGACATACTTACTAATTATACGATTGTGAAGCCATACGTTCGGACTGGGAACATTGCGCAGAAATCTTTTCGAGCCACTTC
AAACCTGCCAAACTGTTCTGACGCCCGTTGAAAAGCGTTGACTGGTTTACCTTGTACAACAAGACACTAAATTCAGCTACTAACCTTCTCTTGTTTATAC
ACCATAACTTTTGAGATGGTAATCCGAATTGAATGTGCCATTTGTACCGCGAACAACAGCTTAACATGGGTTAATGTTCTAATTTGAACCTCACTCCAGC
AATATTGCCGATGTGAGATTCCTGGCTTCCAGAAGACGGAGTTGATGATGTTCTAGAAGGAAATAAGCGCTATATATTTCTTCTCATCTTCAAAGCCATT
CCGTCCAAGGTATATCCTTTAACAATGTTTACTATATCAGAAGCTTAAGGGTGGCAAGTTGCGAAGTCATCAGAAAAAACACGTCACAAATGCTTACTCT
CATGACAGATGGCGGTCTAATTGTTCAACACATTGATGTCGAACAAACGTCTTCTCGAGCGACACTTTTggaattcctagaaaggtcAATTGGTAGCTTT
CTGAATTTGGTCAGGACCGGTTTTGCTCAAAACTCAATGACGCTCACTCACAGAATGTCATAATGTAGTAATACAGTTCGTCCAATCATTTGTTGCCATT
ACAATGACGTGATTTGATTTACTAAATCACAGCACGGAGTGGGACCTCGTCGATACGTTACTGCTTGCAAATCTTCAGTAATTCAAATTTGCAACATTGA
AATGGTATCGAAAGTATCGAAAGTCACCTATTGCGCATACTACAGAAGACATCAAGGCTAGTCGTAATGTAAGCAATAACGATGACATCATGAACCACTG
AGTTCTAATTCCTATTTAAACCGAGAGAATTAAAACAATATAAATGCTTGCGATCATATCATCACCGGTATAAAACACTGTTtttgtgaaaaaaaaaaaa
ctatTTATCACACAGTTAAAACATGTGGACTTGAGTCCCACTTTACGATATCACCAAGTCCAATCAGAATCAAGGACATTTTGCGCTGTCCCAAAGTTCA
CTTAAACGGATGTGGTTCATCAAAGCTTCCAGCAGCTTTTCGCTCATAGTTTATTTTGCTACGTAATACTCATCCACTCGGTTCGAGTGGTTGGCTGCGT
AATGGCATGGCGAAGAGTGTTTTTCGTCATAGTTCTTGGCATCCTTGCCAAAGAGGTGTCCGCCTCATTCAAGACAAGTGATATAATTCATCGATTTACA
AGAAGAACTATGTCAATGTCTACACCAGTCCAAGATTCTGGCtcaagctcagggtcatCAGTATCTGAATCCGAGCCAATCGAGTTAATCATAGAAAAAT
TGATAGCTTCAGCCTCGGCTTCAGGGTCCGTCTCATTTGAGGCGGCGTTTGAAGCGCTGTCCACCTCAAAATGGAGAAGAGAACAGTCGAATTCGTCCAA
AGTTTTTGTATCTTCAATTGAAACACAAGATGCAAAGGTGACCGTGGCCTCGAGCTCTTCGTCCAATTACTCGGCTTTGATCACTTATGGATCTAGCACT
TCGTTTAAACTTGCCACGCCTCTCACTGCCAAAAGTTCGGTAGTACCAACATACCGCAATTGGGTCGGTCCTCACAAGTTGCAAGGTGATGCTGCTTGCT
GGCGTGAAGCTCATATTATGGACGAGTGCCCGTCAAATTACGACCGTAATGATGCCACTAACACGTGCTGGACAGAGTGTCCGATTGAGTTTCCAGTCGA
ATGTGGGGTCGAATGCGTTCGTCAGAACGACGATTGCGGCCGTGAAATATTTTACAAAGTCTCGTCTATTATCAACGTCGGTCTCAATGGAATTATGGAC
AATTGGTTTGGCAAGTTTGCCAACATGGCCAAGTCAGTTCGAACCACTGTATATTGTTCATGTATGATTCTCGGCTTGATCCGAGCCATGCTTCGGTACA
TTCGAAGCGTTCAAAGTGCCGATCCACAAGCAACTCGGGACAAGATTTTGGCTGCTTTGTACCAGTCAAATGTTGTGGTGGTCGAAC